Silentfect

A pool of four individual ON-TARGETplus siRNAs (Dharmacon) was transiently transfected using siLentFect (Bio-Rad), yielding a final concentration of 5 nM siRNA. The transfection was repeated after 3 days, and the silenced MDM were infected with bacteria or stimulated with ligands for 4 h. RNA was isolated with an RNeasy 96 Plus kit (Qiagen), cDNA was transcribed with a Maxima cDNA synthesis kit (Thermo Fisher Scientific), and relative quantification by qPCR was done with StepOnePlus using TaqMan probes (Life Technologies) and Perfecta qPCR FastMix from Quanta. Probes used were: IFNβ, Hs01077958_s1; TNF, Hs00174128_m1; IL-6 Hs00985639_m1; IL-12A Hs1073447_m1; TBP, Hs00427620_m1, IKKβ Hs00233287_m1, cGAS/MB21D1 Hs00403553_m1, MyD88 Hs00182082_m1, STING/TMEM173 Hs00736958_m1, TLR7 Hs00152971_m1, TLR8 Hs00607866_mH, IRF5 Hs00158114_m1, and TBK1 Hs00179410_m1. TBP served as endogenous control, and relative expression was calculated as fold induction by stimulation or infection.

In order to silence TNFR gene, we used the siRNA that targets TNFRSF1A (Integrated DNA Technologies, USA) and the siRNA negative control, that does not target any known sequence. Transfection with 10 nM of siRNA duplex was performed using the cationic lipid siLentFect (BioRad, CA, USA) according to the manufacturer’s recommendations. Cells were transfected for 48 h and then they were stimulated with 0.1 ng/ml of IL1β in presence or not of 200 ng/ml of PGRN for 48 h.

AG1523 fibroblasts were seeded at 50% confluence in 6-well culture dishes and transfection was performed using Silentfect (Bio-Rad Laboratories AB, Solna, Sweden) as per the manufacturer’s instructions. Control siRNA, LXR-α or LXR-β siRNA were added to the cells at 50 nM for 24 h at which point the medium was changed to serum-free medium containing 5 ng/ml TGF-β or vehicle. Cells were maintained for an additional 24 h in TGF-β and then harvested for RT-PCR or immunoblotting. For luciferase and shRNA silencing assays, AG1523 fibroblasts were transfected as above except that Lipofectamine 3000 (Invitrogen/Life Technologies Corp., Foster City, CA, USA) replaced Silenfect.
MEFs were seeded at 70% confluence in 6-well dishes and transfection was performed using Fugene HD (Roche Diagnostics Scandinavia AB, Bromma, Sweden) according to the manufacturer’s protocol (6:1 (v/v) Fugene to DNA ratio). Twenty four hours after transfection, cells were stimulated with TGF-β for 72 h prior to harvesting lysates for immunoblot of fixing cells for immunofluorescence.

Transfection of the ABCG2 (5′-GCAGAUGCCUUCUUCGUUA-3′) and P-gp siRNA (5′-GAGCUUAACACCCGACUUA-3′) (20 nM), (Dharmacon, Lafayette, CO, USA) was conducted using SilentFect (Bio-Rad) according to the manufacturer’s instructions. Non-targeting siRNA duplex (Dharmacon, Lafayette, CO, USA) was used as control. MiR-199a-3p mimic or nonspecific miRNA (100 nM), (RiboBio, China) were transfected with SilentFect according to the manufacturer’s protocol.

Once reached 70% of confluence, GBM cells were transfected with siLentFect (#170-3360; Bio‐Rad Laboratories AB) and the respective siRNA (20 nM), according to the manufacturer. After 48 h, the cells were collected for knockdown validation and seeded for further experiments. The human‐specific siRNA oligonucleotides (QIAGEN) were: a non-mammalian siRNA (#SI03650325) and a set of four different siRNA against the target mRNA (siABCB1 A: #SI00018718–ATCGAGTCACTGCCTAATAAA; siABCB1 B: #SI00018732–GACAGAAAGCTTAGTACCAAA; siABCB1 C: #SI03028116–AACATTCGCTATGGCCGTGAA; siABCB1 D: #SI03040156–ACCGGACATCCCAGTGCTTCA).

Three different concentrations of siRNA HCG18a (siHCG18a), siHCG18b, and siHCG18c were transfected using a mixture of siRNA (50 nm); scrambled was used as a control group (Thermo Fisher Scientific, Inc.). SiLENTFECT (BIO-Rad Laboratories, Hercules, CA, USA) transfection was performed according to vendor requirements. Cardiac fibroblasts were inoculated 8 h before transfection and transfected 2 days later.

For siRNA‐driven knockdowns, cells of 80% confluency were transfected with 20 nm of ON‐TARGETplus SMARTpool human NOX4 siRNA, with a pool of four different siRNAs that target several NOX4 transcript variants (L‐010194‐00‐0005), with individual sequences targeting NOX4 transcripts (J‐010194‐07‐0002, which targets 7 out 15 variants; J‐010194‐08‐0002, which targets 13 out of 15 transcript variants) and with control siRNA (D‐001810‐10‐05) (GE Healthcare Dharmacon, Lafayette, CO, USA). The transfections were done using the cationic lipid reagent silentFect™ (Bio‐Rad, Hercules, CA, USA), according to manufacturer’s instructions.
Different overexpressing stable clones were created using the U3034MG‐MS cell line with pcDNA empty plasmid and pcDNA‐V5‐NOX4, which was kindly supplied by Professor Ulla Knaus (University College of Dublin, Ireland). Using TransIT‐X2^® Dynamic Delivery System (Mirus, Madison, WI, USA), according to manufacturer’s instructions, 80% confluent cells were transfected and 48 h after transfection, 1 mg·mL⁻¹ of Geneticin (G418) (Thermo Fisher Scientific) was added to select the positively transfected cells.