Epitope-containing minigene sequences were generated by custom synthesis (Twist Bioscience). Smaller fragments were amplified by PCR from minigenes with custom primers (Integrated DNA Technologies) using Q5 high-fidelity DNA Polymerase. Each construct was flanked by unique SpeI and BamHI sites to enable efficient cloning into a pLVX-EF1α-IRES-Puro lentiviral vector, which places the respective fragment upstream of an in-frame, T2A-linked mTagBFP2 (46 (link)) sequence. Lentiviral transduction included an additional pre-incubation step of the B-LCLs with 4 nM BX-795 hydrochloride. Viral supernatant was replaced with fresh medium 24 hours after transduction. Seventy-two hours after this medium change, the expression was verified by flow cytometric analysis of BFP and functional assays were performed.
Custom primers
Manufactured by Integrated DNA Technologies
Sourced in United States
Custom primers are short, synthetic DNA sequences designed to serve as starting points for DNA amplification or sequencing. They are used to target specific regions of a DNA template, allowing for selective and controlled replication or analysis of genetic material.
Automatically generated - may contain errors
Lab products found in correlation
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Quantimir rt kit, by System Biosciences (2 mentions)
Faststart universal sybr green master mix, by Roche (2 mentions)
Sybr select master mix, by Thermo Fisher Scientific (2 mentions)
Sybr green master mix, by Thermo Fisher Scientific (2 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (2 mentions)
Cfx connect real time pcr detection system, by Bio-Rad (2 mentions)
Tri reagent, by Merck Group (1 mentions)
Sybr green supermix, by Quantabio (1 mentions)
Rt2 ht first strand kit, by Qiagen (1 mentions)
Rnaqueous micro kit, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Mini beadbeater 16, by Biospec (1 mentions)
1 mm zirconia silica beads, by Biospec (1 mentions)
Taq based master mix, by Meridian Bioscience (1 mentions)
Quantstudio 6 flex system, by Thermo Fisher Scientific (1 mentions)
17 protocols using custom primers
1
Lentiviral Transduction of Epitope-Containing Minigenes
2
Decaffeinated Green Tea Extract Analysis
3
Real-Time qPCR Quantification of mRNA and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated (Fisher Scientific) from cultured cells following treatment with ethanol or acetaldehyde. cDNA was synthesized using the QuantiMiR™ RT kit (System Biosciences) as per the manufacturer’s instructions. Real-time PCR reaction mixes were created using FastStart Universal SYBR Green Master Mix (Roche Diagnostics), and run on a StepOnePlus™ Real-Time PCR System (Applied Biosystems) using the following program: 50°C for 2 min, 95°C for 10 min, 95°C for 30 s, and 60°C for 1 min, for 40 cycles. Relative expressions of mRNAs and miRNAs were calculated based on the RQ = 2^-ddCt method. U6 primers and a Universal Reverse Primer were used from the QuantiMiR™ RT kit, and custom primers (Integrated DNA Technologies) were ordered using the sequences listed in S2 Table .
4
Gene Expression Quantification by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Punches were taken on a sliding freezing microtome from the LA using a 1 mm punch tool from 400 μm thick sections. For RNA isolation, samples were processed using an RNAqueous Micro Kit (ThermoFisher). For cDNA synthesis, a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems) was used. Quantitative real-time PCR (qRT-PCR) was performed using the ΔΔCt method using custom primers (Integrated DNA Technologies, Coralville, IA, USA) for Arc (Forward CCCTGCAGCCCAAGTTCAAG; Reverse GAAGGCTCAGCTGCCTGCTC) and Egr-1 (Forward AGCGAACAACCCTATGAGCA; Reverse TCGTTTGGCTGGGATAACTC). Relative gene concentrations were normalized to GAPDH (Forward GCATCCTGCACCACCAACTG; Reverse ACGCCACAGCTTTCCAGAGG). Data were analyzed using a two-tailed t-test with a significance threshold of p < 0.05. Data are normalized to GAPDH and then expressed as the average threshold cycle (Ct) difference between groups. Average fold change values were then calculated and values were expressed as a percentage of the control.
5
Quantitative Molecular Profiling of Host and Parasite
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For tissue-level analysis, one-fourth of a mouse brain was placed in 1 mL Trizol (Ambion), mechanically homogenized using 1 mm zirconia/silica beads (Biospec) for 30 seconds using a Mini-BeadBeater 16 (BioSpec). For gene expression analysis of magnetically-enriched cells, cells were homogenized in Trizol by pipetting. RNA was extracted from Trizol according to manufacturer’s instructions (Invitrogen). High Capacity Reverse Transcription Kit (Applied Biosystems) was used to generate cDNA. Quantitative PCR was performed using 2X Taq-based Master Mix (Bioline) and TaqMan gene expression assays (Applied Biosystems), or custom primers (Integrated DNA Technologies), run on a CFX384 Real-Time System thermocycler (Bio-Rad Laboratories). Murine Hprt and T. gondii Act1 were used for normalization for analyzing host and parasite gene expression, respectively, and relative expression is reported as 2(−ΔΔCT). The following Thermo Fisher mouse gene probes were used: Stat1 (Mm00439518_m1), Hprt (Mm00446968_m1), Ifng (Mm01168134_m1), Nos2 (Mm00440502_m1), Il6 (Mm00446190_m1), Icam1 (Mm00516023_m1), Vcam1 (Mm01320970_m1), Tnfa (Mm00443258_m1), Ccl2 (Mm00441242_m1), Ccl5 (Mm01302427_m1), Cxcl9 (Mm00434946_m1), Cxcl10 (Mm00445235_m1). custom primers for used for analyzing T. gondii genomic DNA and gene expression were used and are provided in S1 Table
6
Liver and Muscle Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was isolated from frozen liver and muscle samples using Quick-RNA™ MiniPrep Plus (Zymo Research, California, U.S.A.) following manufacturer’s instructions and mRNA was reverse-transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Warrington, U.K.). Quantitative PCR (qPCR) was used to assess the expression of Pgc1a, Tfam, Cox4, Nrf1, Nfe2l2, Cat, Sod1 and Sod2 mRNA in triplicate using a QuantStudio 6 flex system (Applied Biosystems) with SYBR® Select Master Mix (Applied Biosystems), and custom primers (Integrated DNA Technologies, Iowa, U.S.A.). Primer sequences used are found in Table 1 . Primer specificity was verified by melt curve analysis and in all cases detected a single peak. Expression of mRNA was normalised to a geometric mean of β2-microglobulin (β2M) and β-actin mRNA expression. Differences in gene expression were determined using the 2−ΔΔCT method, and reported as fold change (relative to VEH).
7
Targeted Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from KCs and ECs were isolated using Trizol reagent per manufacturer’s instructions. Reverse-transcription using First strand kit formed cDNA. Genes reported in the literature to be regulated by IL-1 and relevant to the pathogenesis of skin or vascular inflammation/atherosclerosis, were tested by real-time PCR using custom primers (Integrated DNA Technologies, Coralville, IA).
8
Optimized Cellular Detection Methods
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pfx DNA polymerase, RNase-OUT, SuperScript-III reverse transcriptase, random hexamers, Lipofectamine2000 transfection reagent, and baculovirus-mediated transduction systems for Golgi detection (Bacman II) were from Invitrogen (Carlsbad, CA); dNTPs, alkaline phosphatase and exonuclease I were from Affimetrix/USB (Cleveland, OH); custom primers were from Integrated DNA Technologies (Coralville, IA); the RNeasy minikit was from Qiagen (Valencia, CA). General chemicals were from Sigma (Saint Louis, MO). Tissue culture media, serum and supplements were from Thermo-Fisher (Waltham, MA).
9
Quantitative RT-PCR Assay for Viral RNA
10
Quantitative Analysis of Plasmid DNA Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After transfection, the cells were incubated and lysed as above. The lysates were pre-cleared with Protein A Agarose beads (Cell Signaling Technology) by shaking for one hour at 4°C. Protein was pulled down by Protein A Agarose beads in accordance with manufacturer's instructions using specific antibodies listed above. The beads were washed three times with lysis buffer and resuspended in molecular grade water for PCR analysis. Bound gWizGFP was quantified by PCR (CFX96 Real Time PCR Detection System, Bio-Rad, Hercules, CA, USA) using custom primers (Integrated DNA Technologies, Coralville, IA, USA) to base pairs 567–751 within the CMV-IE promoter/enhancer region (forward 5′- ATCATATGCCAAGTACGCCC-3′, reverse 5′- TGAGTCAAACCGCTATCCAC-3′) and base pairs 2085–2221 within the GFP open reading frame (forward 5′- CTCTGTGCTATGGTGTTCAATG-3′, reverse 5′- TGTCTTGTAGTTGCCGTCATC-3′) in SYBR Select Master Mix (Applied Biosystems, Foster City, CA , USA). Water was used as no template control. Absolute quantification was performed by comparison to serial dilutions of gWizGFP DNA, then relative quantification was performed by comparison to control sample incubated with anti-CD4 antibody.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!