Gotaq g2 hot start green master mix

10 μl of T. muris eggs were dropped onto LB plates (NYU Reagent Preparation Core) and incubated at 37°C overnight. Colonies that grew were then picked and added to Eppendorf tubes containing GoTaq G2 Hot Start Green Master Mix (Promega). DNA was extracted by heating the mixture at 95°C and the 16S rRNA gene was then amplified using 16S-Fwd (CCGATATCTCTAGAAGAGTTTGATCCTGGCTCAG) and 16S-Rev (CCGATATCGGATCCACGGTTACCTTGTTACGACTT) primers in a PCR reaction. PCR product was sent to Macrogen for sequencing and the sequences were aligned to the EzBioCloud 16S rRNA database for initial taxonomic identification [17 (link),53 (link)].

Genomic DNA was isolated with GenElute Mammalian genomic DNA isolation kit (catalog no.: G1N70-1KT; Sigma), and PCR was carried out with GoTaq G2 Hot Start Green Master Mix (catalog no.: M7422; Promega). PCR product bands were detected following separation on a 1% agarose gel and isolated by cutting out the gel band and isolation with Monarch DNA gel extraction kit (catalog no.: T1020S; NEB).
Total RNA was isolated with Miniprep RNeasy Mini Kit (catalog no.: 74104; Qiagen), and first strand complementary DNA (cDNA) synthesis was carried out with Qscript cDNA synthesis Supermix (catalog no.: 95048-100; Quanta Biosciences). For the quantitative PCR, we used SensiFast SYBR Hi-ROX kit (catalog no.: BIO92005; Labgene), and the reaction was performed on StepOnePlus Real-Time PCR System (catalog no.: 4376600; Thermo Fisher Scientific). The following primers were used: 18s forward 5′-GGCCCTGTAATTGGAATGAGTC-3′, 18s reverse 5′-CCAAGATCCAACTACGAGCTT-3’; UNC93B1 forward 5′-CTGCTCACCTTCATCCTCTTT-3′, UNC93B1 reverse 5′-GTGCTGAGTCCAGTCTTGTT-3’; STIM1 forward 5′-CCTCTCTTGACTCGCCATAATC-3′, STIM1 reverse 5′-CTTGGAGTAACGGTTCTGGATATAG-3’.

SNPs were selected using the dbSNP database ( http://www.ncbi.nlm.nih.gov/projects/SNP/ ) and were chosen based on functional significance. Minor allele frequency according to 1000Genomes database is 0.41 for rs4880, 0.48 for rs7943316, 0.09 for rs1800629, and 0.14 for rs1800795.
All SNPs were analyzed with the Polymerase Chain Reaction-Restriction Fragment Length Polymorphism technique (PCR-RFLP). Samples were amplified in 15 μL reactions containing 7.5 uL of GoTaq^® G2 Hot Start Green Master Mix ( Promega Corporation, St. Madson - USA ), 1 μL of each primer (10 μM), 1 μL of DNA, and nuclease-free water. Primer sets as well as the enzymatic digestion conditions were the same as previously described.^{16 (link) , 18 (link) , 24 (link)} Genotypes were analyzed through vertical electrophoresis in 6% polyacrylamide gels, followed by coloring with silver nitrate. The genotypes were identified by their band pattern according to literature.^{21 (link) , 25 (link) , 31 (link)}SOD2 restriction fragments: CT (246, 157, 89 bp) and TT (157, 89 bp); CAT restriction fragments: TT (249 bp), AA (175, 74 bp), and AT (249, 175, 74 bp); TNF-α restriction fragments: GA (107, 87 bp), GG (107bp), and AA (87 bp); and IL-6 restriction fragments: CC (117bp), GG (139bp), and GC (139, 117bp).

DNA was extracted from individual mosquitoes using the QIAcube HT robotic workstation and the associated Cador Pathogen 96 QIAcube HT Kit (Qiagen) following manufacturer's recommendations, eluted with 100 μl AVE buffer (Qiagen) and eventually stored at −20°C until molecular investigations. PCRs were performed with 0.5 ng of genomic DNA in a 25 μl final volume reaction containing 8.5 μl of water, 12.5 μl of GoTaq^® G2 HotStart Green Master Mix (Promega), and 1 μl of each primer (10 μM) (Supplementary Table 2). All PCR programs included an initial denaturation step at 95°C for 5 min, followed by 36 cycles (30 cycles for the COI gene) at 94°C for 30 s, 52°C−59°C for 60 s and 72°C for 90 s, and a final elongation step at 72°C for 7 min. Amplified DNA fragments were ran on 1.5% agarose gel electrophoresis stained with 1X GelRed^TM (Biotium Inc.) and visualized under ultraviolet light. PCR products were Sanger sequenced on both strands (Genoscreen, Lille, France). Only unique generated sequences were submitted to GenBank under the following accession numbers: OR282837-OR282884, OR296528-OR296530, OR296531-OR296533, OR296534-OR296536, OR296537-OR296539, OR296540-OR296543, and OR296544-OR296547 for COI, coxA, fbpA, ftsZ, gatB, hcpA, and wsp, respectively.

Genomic DNA and total RNA were extracted from bladder cell lines and Cohort 2 using AllPrep DNA/RNA Kit (Qiagen, Germantown, MD, USA) and cohort 3 using QIAamp DNA FFPE Tissue Kit (Qiagen). Extracted DNA from Cohort 1 was provided by EDRN. PCR primers were designed to amplify the promoter and each exon in PAI1. DNA were used for PCR amplification. PCR reactions were carried out in a total volume of 25 µL containing genomic DNA template, 0.4 µM of each PCR primer, and GoTaq G2 Hot Start Green Master Mix (Promega, Madison, WI, USA), except for PAI1 exon 9. Due to the length of exon 9′s PCR products, AccuStart II GelTrack PCR Super Mix (Quanta BioSciences, Inc., Gaithersburg, MD, USA) was used. Forty cycles of 30 s at 94 °C, 30 s at 60 °C, and 30–120 s at 72 °C (per intended PCR product) were performed in a programmable thermal cycler (Bio-Rad, Hercules, CA, USA). PCR products were checked on a 1.5% agarose gel, followed by PCR purification and bidirectional Sanger sequencing (Psomagen, Rockville, MD, USA). Sequence analysis was performed using Geneious, (Geneious version 8, “http://www.geneious.com (accessed on 5 August, 2015)”, [51 (link)]) and detected variants were confirmed against a RefSeq genomic DNA sequence (PAI1: NG_013213.1). All genetic alterations identified by Geneious were compared to the NCBI SNP database (dbSNP).