RNA was isolated using the miRNEasy Mini Kit (Qiagen) according to the manufacturer’s instructions including the optional on-column DNase treatment (Qiagen). qRT-PCR was conducted on the Dnase-treated RNA using the KAPA SYBR-Fast Onestep qRT-PCR kit according to the manufacturer’s instructions. Primers used include the following: GAPDH—Fw 5′ GGAGCGAGATCCCTC CAA AAT 3′, Rv 5′ GGCTGTTGTCATACTTCTCAT GG 3′; CYP24A1—Fw 5′ CATCATGGCCATCAA AACAAT 3′, Rv 5′ GCAGCTCGACTGGAGTGAC 3′; FN1—Fw 5′ GCAGCCTGCATCTGAGTACA 3′, Rv 5′ GGTGGAATAGAGCTCCCAG 3′; and VDR—Fw 5′ ACTTGCATGAGGAGGAGCAT 3′, Rv 5′ TCGGCTAGCTTCTGGATCAT 3′. Reactions were run on a Thermofisher (Quant Studio 3) thermocycler. All qPCR assays were conducted in triplicate.
On column dnase treatment
Manufactured by Qiagen
Sourced in Germany, United States, United Kingdom
The On-column DNase treatment is a laboratory equipment designed to remove genomic DNA from RNA preparations during RNA purification. It facilitates the efficient elimination of DNA contamination from RNA samples, ensuring the purity of the RNA for subsequent analyses.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (27 mentions)
Rneasy kit, by Qiagen (9 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (7 mentions)
2100 bioanalyzer, by Agilent Technologies (5 mentions)
Trizol, by Thermo Fisher Scientific (5 mentions)
Iq sybr green supermix, by Bio-Rad (4 mentions)
Agilent bioanalyzer, by Agilent Technologies (4 mentions)
Rneasy plant mini kit, by Qiagen (4 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (4 mentions)
Oligo dt, by Thermo Fisher Scientific (4 mentions)
Mirneasy mini kit, by Qiagen (3 mentions)
Allprep dna rna mirna universal kit, by Qiagen (3 mentions)
Rnalater, by Thermo Fisher Scientific (3 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (3 mentions)
Hiseq 2500, by Illumina (3 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Rlt buffer, by Qiagen (3 mentions)
Rneasy spin column, by Qiagen (3 mentions)
Novaseq 6000, by Illumina (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
91 protocols using on column dnase treatment
1
Quantitative RNA Expression Analysis
2
Quantifying Bt mRNA Levels by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was prepared from 1.0 mL of Bt cell culture pre-treated with RNA protect (Qiagen) using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. Contaminating DNA was removed using on-column DNase treatment (Qiagen) during purification according to the manufacturer’s instructions. cDNA was synthesized from 1.0 μg of RNA using Superscript VILO IV master mix (ThermoFisher) according to the manufacturer’s instructions. mRNA levels were measured by quantification of cDNA using Fast SYBR Green PCR Master Mix (Applied Biosystems) and primers listed in Table S2 using a QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems, Waltham, Massachusetts, USA). Data were normalized to 16s ribosomal RNA from 1,000-fold diluted cDNA as previously described26 (link). qPCR primers are listed in Table S2.
3
Quantitative Gene Expression Analysis in HaCaT Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from HaCaT cells using the RNeasy Mini Kit (Qiagen,
Hilden, Germany), along with on-column DNase treatment (Qiagen), as per the
manufacturer’s instructions. A cDNA synthesis kit (MGmed, Seoul, Korea)
was used to synthesize cDNA from 1.5 μg of total RNA, using the Oligo
(dT) 30 primer. Target gene expression was analyzed using the gene-specific
primers listed inTable 1 . The amplified
products were subjected to electrophoresis on a 1.5% agarose gel and
visualized with ultraviolet illumination.
RT-PCR was performed at 94°C for 2 min, followed by 35 cycles at
94°C for 10 s, 60°C for 30 s, and 72°C for 20 s. For QPCR,
cDNA strands synthesized from the isolated total RNA were used as templates. PCR
was performed on a StepOnePlus Real-Time PCR System (Qiagen), using the SYBR
Green PCR Mastermix (BioRad, Hercules, CA, USA). The cycle threshold values were
normalized against the GAPDH gene expression levels. PCR was performed at
94°C for 1 min; subsequently, 40 cycles were performed at 94°C for
10 s, 57°C for 10 s, and 72°C for 20 s.
Hilden, Germany), along with on-column DNase treatment (Qiagen), as per the
manufacturer’s instructions. A cDNA synthesis kit (MGmed, Seoul, Korea)
was used to synthesize cDNA from 1.5 μg of total RNA, using the Oligo
(dT) 30 primer. Target gene expression was analyzed using the gene-specific
primers listed in
products were subjected to electrophoresis on a 1.5% agarose gel and
visualized with ultraviolet illumination.
RT-PCR was performed at 94°C for 2 min, followed by 35 cycles at
94°C for 10 s, 60°C for 30 s, and 72°C for 20 s. For QPCR,
cDNA strands synthesized from the isolated total RNA were used as templates. PCR
was performed on a StepOnePlus Real-Time PCR System (Qiagen), using the SYBR
Green PCR Mastermix (BioRad, Hercules, CA, USA). The cycle threshold values were
normalized against the GAPDH gene expression levels. PCR was performed at
94°C for 1 min; subsequently, 40 cycles were performed at 94°C for
10 s, 57°C for 10 s, and 72°C for 20 s.
4
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the RNeasy mini kit (Qiagen) following the manufacturer's instructions. On-column DNAse treatment (Qiagen) was used to remove contaminating DNA leftovers. RNA concentration and purity were analyzed using Nanodrop spectrophotometer (Nanodrop technologies) readings at 260 and 280 nm. Complementary DNA (cDNA) was synthesized using Invitrogen superscript kit according to the manufacturer's instructions and using random hexamer primers for reverse transcription. Reverse transcription was performed at 50°C for 55 minutes, followed by 5 minutes of incubation at 85°C to inactivate the reverse transcriptase enzyme. cDNA samples were placed on ice and stored at -20°C until further use.
5
Drought-Responsive Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Flag and second leaf samples from six independent plants were collected in the morning of the 17th day of drought stress and immediately frozen in liquid nitrogen. Total RNA was extracted using Plant/Fungi Total RNA Purification Kit (Norgen Biotek Corp., Canada) with on-column DNase treatment (Qiagen, Germany). RNA integrity was assessed with 2100 Bioanalyzer (Agilent Technologies Inc., Germany) and first strand cDNA was synthesized using qScript™ cDNA Synthesis Kit (Quanta Biosciences Inc., USA) following manufacturer’s instructions. qPCR was carried out using PerfeCTa® SYBR® Green FastMix® (Quanta Biosciences Inc., USA) on the PikoReal RT-PCR system (Thermo Fisher scientific Inc., USA). Gene-specific primers were designed using Primer-BLAST software [75 (link)] (Additional file 14 : Table S8). The 2-∆∆CT method [76 (link)] was used to normalize and calibrate transcript values relative to two housekeeping genes Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, BRADI3G14120) and S-adenosylmethionine decarboxylase (SamDC, BRADI2G02580) [77 (link)], whose their expression did not change in response to drought.
6
RNA and DNA Isolation from Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA and RNA from FAC-sorted cells were isolated simultaneously from the same cell pellet using an AllPrep DNA/RNA Micro Kit (Qiagen) with on-column DNase treatment during the RNA isolation. Cortical and spinal cord tissues RNA were isolated from three biological replicates for each age and condition using TRIzol (Invitrogen) extraction and isopropanol precipitation. RNA samples were resuspended in water and further purified with RNeasy columns with on-column DNase treatment (Qiagen). RNA purity was assessed by measuring the A260/A280 ratio using a NanoDrop, and RNA quality checked using an Agilent 2100 Bioanalyzer (Agilent Technologies). DNA quality was checked using a NanoDrop and aQubit Fluorometric quantitation (Thermo Fisher).
7
Simultaneous DNA and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sorted cells were lysed in RLT Plus Buffer (Allprep isolation kit, QIAGEN, cat# 80224). Total DNA and total RNA were extracted simultaneously from the lysates using the Allprep DNA/RNA/miRNA Universal Kit (QIAGEN, cat# 80224) with on-column DNase treatment (QIAGEN, cat# 79254). RNA samples were quantified using Qubit 2.0 Fluorometer (Life Technologies), and RNA integrity was checked with 2100 Bioanalyzer (Agilent Technologies).
8
Transcriptome Analysis of Stem Cells and Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from undifferentiated pluripotent stem cell cultures (2 BL6 replicates, 2 CAST replicates) following feeder depletion and from pluripotent stem cell-derived motor neurons (4 BL6 replicates, 1 CAST replicate) following 7 days of culture on laminin. For pluripotent stem cell samples, we used the RNAqueous™-Micro Total RNA Isolation Kit (Thermo Fisher Scientific). For neuron samples, we used the RNAeasy-Micro Total RNA Isolation Kit (Thermo Fisher Scientific). In each case we used on-column DNase treatment (QIAGEN, Hilden, Germany). RNA samples were processed into mRNA libraries and sequenced on an Illumina NovaSeq 6000 Sequencing System, yielding ~20M paired-end 150 bp reads per sample. Read-mapping was as above. Normalized read counts from these stem cell and neuronal RNA-seq datasets are reported in Table S2 .
For principal component analysis, we filtered expression data from purebred stem cell and neuron samples (Skelly et al. [2020 (link)] and data generated in this study;Table S2 ) to remove non-coding RNAs and mitochondrially-encoded genes. For the remaining genes, we calculated log2(TPM+1) values for input into the prcomp module in R.
For principal component analysis, we filtered expression data from purebred stem cell and neuron samples (Skelly et al. [2020 (link)] and data generated in this study;
9
RNA Sequencing with Poly-A Selection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the RNAeasy miniprep kit with on-column DNase treatment (Qiagen) according to manufacturer’s protocol. Sequencing was performed after poly-A selection and TruSeq library prep at the Human Genomics facility (www.glimdna.org ) on a HiSeq2000 at paired-end 150 bp. Data were processed per sample using STAR (v2.3.0) (Dobin et al., 2013 (link); Bolger et al., 2014 (link)), picard (v1.90), and GATK (v2.8). Transcript quantification was performed using featureCounts (v1.4.3) against all 57,820 gene features in GENCODE (version date; 2013-12-05) (Harrow et al., 2012 (link); Liao et al., 2014 (link)).
10
Quantitative RT-PCR Analysis of Bradykinin Receptors
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!