Pyromark md system

We measured DNAm of specific regions within target genes by pyrosequencing of the PCR products.^{19 (link)} An amount of 25 ng of bisulfite-treated DNA was used for the initial PCR, and an additional nested PCR was performed with 2 μl of the previous PCR. Reactions were performed using the PyroMark MD System with Pyro Q-CpGt 1.0.9 software (Qiagen) for methylation quantification. Percentage of methylation at each CpG was compared between Li- and VPA- treated rats vs control diet-fed rats.

DNA methylation at selected sites was validated in a subset of the original cohort by the bisulfite pyrosequencing. This subset consisted of 47 male subjects ages 6 to 21. One microgram of human genomic DNA was sodium bisulfite converted using the EZ DNA Methylation kit (Zymo Research) according to the manufacturer’s guidelines. Pyrosequencing was performed using the PyroMark MD system (Qiagen, Valencia, CA) according to the manufacturer’s protocol. Briefly, the PCR was performed with 10 μM primers, one of which was biotinylated for later purification by Streptavidin Sepharose (VWR). The oligonucleotide primers were purchased from IDT and used for the amplified region of DDO: the forward primer, TGTTTAGGAGAAAGGAGTAAGTGATT; the reverse biotinylated primer, ACCCATTATTCACCATACCTACAA; and the pyrosequencing primer, TTTTATGGAGTTGTTTTTGTTAAG. Sepharose beads containing the PCR product were washed and purified using 0.2 M NaOH and the Pyrosequencing Vacuum Prep Tool (QIAGEN). Five microliters of the PCR products was sequenced, and methylation was quantified using the provided software (QIAGEN).

All samples (N = 509) were sequenced for FKBP5 intronic methylation. FKBP5 intron 7 (GRCh37/hg19 Chr 6: 35,558,486–35,558,567) was amplified with a pyromark PCR kit (Qiagen) using primers (FKBP5-F, 5′- GGATTTGTAGTTGGGATAATAATTTGG -3′; and 5′–biotin- TCTTACCTCCAACACTACTACTAAAA -3″) and the following cycling conditions: 95°C for 9 minutes, followed by 42 cycles of 95°C for 30 seconds, 59°C for 1 minute and 72°C for 1 minute, and a final extension step of 5 minutes at 72°C. PCR products were sequenced using a PyroMark MD system (Qiagen), and the sequencing primer FKBP5 SEQ 5′- GGAGTTATAGTGTAGGTTT -3′. Each sequencing run contained no template and genomic DNA negative controls, as well as a methylated and unmethylated controls (Epitect). A bisulfite conversion control within the assay sequence was used to assess conversion efficiency.