Rnaplant plus reagent

Whole C. monnieri plants were collected from Tongcheng city in Anhui Province, China in May 2018, with verbal permission of the Manager Zhongquan Fang (Anhui Bowen agriculture and Forestry Development Co., Ltd), and authenticated by Professor Dequn Wang (Anhui University of Chinese Medicine). Prior to the experiment, the plants were grown at a temperature of 22−26 °C/14−18 °C (day/night) and relative humidity of 65–80%. All samples were rinsed in ultrapure water, and leaves, roots, flowers and stems, which were harvested from three individual C. monnieri plants, were placed in centrifuge tubes, frozen in liquid nitrogen immediately and stored at −80 °C.
Total RNA was extracted from each tissue using RNA plant Plus Reagent (Tiangen, Beijing, China) according to the manufacturer’s instructions. The extracted RNA was checked using a NanoDrop 2000 (Thermo, CA, USA), and the concentration of the isolated RNA, 28S/18S and integrity (RIN) were estimated using an RNA Nano 6000 Assay Kit and the Agilent Bioanalyzer 2100 system (Agilent, CA, USA) (Table S1).

Total RNA was extracted from the above treated samples using RNA Plant Plus Reagent (Tiangen, Beijing, China), and cDNA was synthesized with a PrimeScript first-strand cDNA synthesis kit (Takara, Dalian, China). The genes were randomly selected from DEGs in CtW and CsL. qRT-PCR was performed with KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems, USA) as described in the instructions. The expression levels of genes were normalized to 18S and calculated using the 2^−ΔΔCt method. Three biological replicates were used for qRT-PCR analysis. The primers used in qRT-PCR are listed in Table S1.

RNA extraction was performed using a RNAplant plus Reagent (Tiangen) as previously described (An et al., 2018a (link), 2020 (link)). Quantitative real-time PCR (qRT-PCR) was conducted to identify transgenic material and to detect MdTCP46 and MdBT2 transcripts. To determine the light responses of MdTCP46 and MdBT2, fruit of ‘Red Delicious’ were sampled at 120 d after full bloom and kept in bags in the dark before being placed in the different light-intensity conditions. Three biological replicates and three technical replicates were used in all qRT-PCR reactions. All primers are listed in Supplementary Table S3.

Strawberry fruits at green stage (about 15 days post anthesis, DPA), white stage (about 22 DPA), pre-turning stage (white receptacles with red achenes), turning stage (2 or 3 days after the pre-turning stage), and ripen stage (3 or 4 days after the turning stage) were harvested. The achenes were removed from all the fruits. and then the total RNA was extracted following the manufacturer’s instructions of RNA Plant Plus Reagent (Tiangen, Beijing, China, Cat.DP437). DNase I was used to remove the genomic DNA contamination. First-strand cDNA was synthesized using EasyScript^® One-Step gDNA Removal and cDNA Synthesis SuperMix (Transgen, China). Real-time qPCR was performed using the CFX96 Touch^TM Real-Time PCR System (Bio-Rad, United States) with 2 × M5 HiPer SYBR Premix EsTaq (with Tli RNaseH) (Meibio, China, Cat. MF787-01). The qPCR reaction was performed by pre-denaturing at 95°C for 1 min, followed by 40 cycles of denaturing at 95°C for 5 s, annealing at 60°C for 15 s, and extension at 72°C for 15 s. Melting curve detection from 65 to 95°C was done after the cyclic reactions. Transcript abundance of target genes were calculated using 2^–ΔCt method in comparison with the internal control gene, Fv26S or FvActin. Three biological replicates were used in each assay. The experiments were repeated at least three times. The primer sequences were listed in Supplementary Table 3.

Total RNAs were extracted from each biological sample (leaf, stem, tuber phloem, tuber xylem, male flower, female flower, fruits from three different plants) using RNAplant Plus reagent (TianGen, Beijing, China) according to the manufacturer’s protocol. Two micrograms of each RNA sample was used as the template for first-strand cDNA synthesis using a PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa Biotechnology), according to the manufacturer’s protocol. qPCR was performed using gene-specific primers (Table 4). A housekeeping gene, β-tubulin, was amplified as an internal control [26 (link)]. qPCR was performed on an ABI 7900Fast instrument (Applied Biosystems, Foster City, CA, USA) using SYBR^® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa Biotechnology), cycling between 95 and 60 °C, as per the manufacturer’s protocol, for 45 cycles. The threshold cycle (C_t) was determined using proprietary software from Applied Biosystems. The relative expression data was analyzed using the 2^−ΔΔCt method [40 (link)]. Three technical replicates were analyzed for each biological sample.

Total RNA was extracted from the infected mulberry leaves using RNAplant plus reagent (TIANGEN, Beijing, China) according to the manufacturer's instruction and the quality of the purified RNA was evaluated by gel electrophoresis on 0.8% (w/v) agarose gels. The 5′ and 3′-terminal sequences of the viral genomic RNA were determined by using the RACE cDNA Amplification Kit (BD Biosciences, Franklin Lakes, NJ, USA) coupling with Sanger sequencing. Primers were designed according to the available sequences obtained through viral small RNA deep sequencing. The RACE products were purified using DNA gel recovery kit (Sangon, Shanghai, China) and cloned into the pCR2.1-TOPO vector (Thermo Fisher Scientific, Waltham, MA, USA) before sequencing.

Total RNA was isolated from the treated transgenic Arabidopsis lines OE1, OE4, OE6, and wild-type Arabidopsis using the RNAplant Plus reagent (TianGen, Beijing, China) based on the manufacturer’s instructions. TaKaRa SYBR^® Premix Ex Taq^TM II reagent (TaKaRa, Dalian, China) was used to analyze the expression level of related stress resistance genes in Arabidopsis. The Arabidopsis actin gene was employed as an internal reference. The 2^−ΔΔCt method was used to calculate the relative expression level. Each sample of the experiment had three biological replicates, and the calculated results were plotted with Excel. The detected genes and their specific primers are as follows: AtIAA4 (QAtIAA4-F: GCAGAGGAGGCAATGAGTAGTG and QAtIAA4-R: GAGCATCCAGTCACCATCTTTG), AtRD29B (QAtRD29B-F: ATTCACCATCCAG AAGAAGAGCATC and QAtRD29B-R: ACTTCTGGGTCTTGCTCGTCA), AtLBD18 (QAtLBD18-F: GTCGCTCACATCTTTGCTCTTC and QAtLBD18-R: GTCGCTCACATC TTTGCTCTTC), AtActin (QAtActin-F: TTCCTCATGCCATCCTCCGTCTT and QAtActin-R: CAGCGATACCTGAGAACATAGTG) [35 (link)].