Huh-luc/neo-ET cells were seeded at a density of 1.6 × 105 cells in T25 cm2 flask and treated with either DMSO, or herb extracts for different times. At the end of the treatment, total RNA was extracted by Trizol (Life Technologies). One microgram of total RNA was reverse transcribed into cDNA with ProtoScript® II Reverse Transcriptase (New England Biolabs, Ipswich, MA, USA). qPCR was performed in triplicates for all samples using the Mx 3005P qPCR system (Agilent, Santa Clara, CA, USA) with SYBR Master Mix (Bio-Rad, Hercules, CA, USA). Absolute copy number of HCV RNA was determined with the standard curve generated by using the linearized pFK-I389/NS3-3′ plasmid bearing the HCV genome and 18S rRNA was included as a control. The primers were as follows: forward primer 5′-CTTCACGCAGAAAGCGTCTA-3′ and reverse primer 5′-CAAGCACCCTATCAGGCAGT-3′ for HCV; forward primer 5′-GTAACCCGTTG AACCCCATT-3′ and reverse primer 5’-CCATCCAATCGGTAGTAGCG-3′ for 18S rRNA.
Sybr master mix
Manufactured by Bio-Rad
Sourced in United States
SYBR master mix is a pre-formulated solution containing all the necessary reagents required for real-time PCR amplification and detection using SYBR Green I dye. The core function of the SYBR master mix is to enable efficient and sensitive quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Iscript cdna synthesis kit, by Bio-Rad (7 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (3 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Rneasy mini kit, by Qiagen (2 mentions)
Tri reagent, by Thermo Fisher Scientific (2 mentions)
Rnazol, by Molecular Research Center (2 mentions)
Cfx96 touch real time pcr detection system and software, by Bio-Rad (2 mentions)
Cfx96 real time pcr system, by Bio-Rad (2 mentions)
Rneasy plus kit, by Qiagen (2 mentions)
Iscripst kit, by Bio-Rad (2 mentions)
Hoechst 33342, by Thermo Fisher Scientific (2 mentions)
Rna extraction kit, by Aidlab (2 mentions)
Western lightening plus ecl enhanced chemiluminescence substrate assay kit, by PerkinElmer (2 mentions)
High capacity cdna kit, by Thermo Fisher Scientific (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Mx3005p qpcr system, by Agilent Technologies (1 mentions)
Protoscript 2 reverse transcriptase, by New England Biolabs (1 mentions)
Propidium iodide rnase staining solution, by BD (1 mentions)
Fitc annexin 5 apoptosis detection kit, by BD (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
24 protocols using sybr master mix
1
Quantification of HCV RNA in cells
2
Quantification of TUC338 and miR-1226-3p Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells or tissues was generated into cDNA via reverse transcription with PrimeScript Reverse Transcriptase (RT) kit (Thermo Fisher Scientific, Inc.). qPCR was preformed to quantify the levels of TUC338 and miR-1226-3p with the SYBR Master Mix (Bio-Rad, USA). The levels of TUC338 or miR-1226-3p was normalized to that of GAPDH or U6 RNA, respectively. Primers used were TUC338 forward, 5′-GCAGCGACAGTGCGAGCT, reverse, 5′-TCCGAGTGAGTTAGGAAG; GAPDH forward, 5′-GGTCTCCTCTGACTTCAACA, reverse, 5′-GTGAGGGTCTCTCTCTTCCT; miR-1226-3p forward, 5′-GCGGCTCACCAGCCCTGTGT, reverse, 5′-CAGCCACAAAAGAGCACAAT; FGF2 forward, 5′-ACTGGCTTCTAAATGTGTTACG, reverse, 5′-TTGGATCCAAGTTTATACTGCC.
3
Quantitative PCR Analysis of TLR9, IL10, and Housekeeping Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissues and cells using RNeasy Mini Kit (Qiagen, Germantown, MD). iScript cDNA Synthesis kit (Bio-Rad) was used for reverse transcription and SYBR Master Mix (Bio-Rad) was used for quantitative PCR. Primers for human TLR9 was obtained from Bio-Rad (proprietory).
The primers used were as follows:
The primers used were as follows:
| Gene | Species | Forward | Reverse |
|---|---|---|---|
| TLR9 | Mouse | ATGGTTCTCCGTCGAAGGACT | GAGGCTTCAGCTCACAGGG |
| IL10 | Mouse | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG |
| GAPDH | Mouse | GGCATTGCTCTCAATGACAA | ATGTAGGCCATGAGGTCCAC |
| RPL27 | Human | GTGGCTGGAATTGACCGCTA | ACAGAGTACCTTGTGGGCATT |
4
RNA Isolation and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with Tri-reagent (ThermoFisher Scientific, Grand Island, NY). Real-time polymerase chain reaction were performed with primers and SYBR master mix (Bio-Rad, Hercules, CA). Amplification of 18S was used as an internal control. Relative messenger RNA (mRNA) expression was quantified using the comparative Ct method and expressed as 2−ΔΔCt.
5
Quantification of PTK6 Expression
6
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The quantity and quality of total RNA were assessed using a NanoDrop 2000 (Nanodrop Technologies; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). A total of 1 μg RNA was reverse transcribed to cDNA, using iScript cDNA Synthesis kit (Bio-Rad Laboratories, Inc.). The RT reaction was performed as follows 5 min at 25°C, 30 min at 42°C, 5 min at 85°C. RT-qPCR analysis was performed using SYBR Master Mix (Bio-Rad Laboratories, Inc.) on a CFX96 Real-Time PCR system (Bio-Rad Laboratories, Inc.), according to the manufacturer's protocol. The PCR conditions consisted of 40 cycles, with 5 sec denaturation at 95°C, 30 sec annealing at 60°C and 5 sec extension at 65°C. The fold change in mRNA was calculated through relative quantification (2−ΔΔCq) with β-actin used as the housekeeping gene (30 (link)). The primers used were as follows: β-actin, forward, 5′-CTGGAACGGTGAAGGTGACA-3′ and reverse, 5′-AAGGAACTTCCTTGAACAATGCA-3′; NAG-1, forward, 5′-CTCCAGATTCCGAGAGTTGC-3′ and reverse, 5′-AGAGATACGCAGGTGCAGGT-3′; and EGR-1, forward, 5′-AGCCCTACGAGCACCTGAC-3′ and reverse, 5′-GGTTTGGCTGGGGTAACTG-3′.
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from transfected cells using Qiagen RNeasy plus kit (Qiagen) followed by reverse transcription of 100 ng RNA into cDNA using iScripst kit (Biorad). A Quantitative real-time PCR (qRT-PCR) reaction was performed using SYBR master mix (Biorad) according to the manufacturer’s protocol (primers used are indicated in the supplementary information (qPCR primer list)). Quantification of RNA expression was normalized based on expression of glyceraldehyde 3-phosphate dehydrogenase and calculated using ΔΔCt. Please refer to Supplementary Table 3 for qPCR primers.
8
Apoptosis and Proliferation Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FITC Annexin V apoptosis detection kit and propidium iodide (PI)/RNase staining solution were purchased from BD Biosciences (San Diego, CA, USA). Hoechst 33342 was obtained from Invitrogen (Carlsbad, CA, USA). [3-(4, 5-dimethylthia-zol-2-yl)-2,5-diphenyltetrazolium bromide] (MTT) was obtained from HXBIO (Hangzhou, China). Polyclonal β-actin and PARP antibodies, and monoclonal pro-caspase-3, cleaved caspase-3 and pro-caspase-7 antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA). RNA extraction kit was purchased from Aidlab Biotechnologies Co., Ltd. (Beijing, China). The iScript cDNA Synthesis kit and SYBR Master Mix were purchased from Bio-Rad Laboratories (Hercules, CA, USA). The bicinchoninic acid (BCA) assay kit was purchased from Pierce (Rockford, IL, USA). The Western Lightening™ Plus-ECL Enhanced chemiluminescence substrate assay kit was purchased from Perkin-Elmer (Waltham, MA, USA). Ki-67, Bax, Bcl-2 and cyclin D1 antibodies for immunohistochemistry were obtained from Wuhan Goodbio Technology Co., Ltd. (Wuhan, China). Transwell plates were purchased from Costar, Inc., (Kennebunk, ME, USA).
9
Comparative Analysis of Viral Infection Responses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human THP-1 monocytes, human primary fibroblasts, mouse L929 fibroblasts, mouse BMDMs, or MLFs were infected with VSV or HSV-1 (MOI = 5) or transfected with HT-DNA (1 μg/ml), unless specifically indicated otherwise. Fibroblasts from control subjects and patients #1 and #2 were infected with VSV or HSV-1 (MOI = 5) for 6 h. Cells were washed with cold phosphate-buffered saline (PBS), and total RNA was extracted using TRIzol reagent (Takara). RNA was digested with DNase I (New England Biolabs) to remove genomic DNA. The two patient blood samples were collected and frozen at −20 °C. One milliliter of blood was used to extract total RNA by a PAXgene Whole-Blood RNA Isolation Kit (PreAnalytiX, Qiagen). One microgram of total RNA was used for reverse transcription with PrimeScript Reverse Transcriptase (Clontech) according to the manufacturer’s instructions. Approximately 0.5% of the cDNA was used as template in each qRT-PCR reaction with SYBR master mix (Bio-Rad) or Taqman (Thermo Fisher). Taqman probes were used to quantify IFIT1 (Hs00356631_g1), ISG15 (Hs00192713_m1), SIGLEC1 (Hs00988063_m1), IFI27 (Hs01086370_m1), and RSAD2 (Hs01057264_m1). The relative expression of the target genes was normalized to the expression level of HPRT1 (Hs03929096_g1) or ACTB.
The primer sequences for qRT-PCR are provided inSupplementary Table .
The primer sequences for qRT-PCR are provided in
10
RNA Isolation and Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolation was conducted using the RNAeasy Plus animal RNA isolation kit with spin column (Beyotime) according to the manufacturer's instructions. RNase R digestion was performed by incubating total RNA from NSCLC cells with 3 U/μg RNase R (Epicenter). The synthesis of complementary DNA was done using 1 ng of total RNA along with an iScript cDNA synthesis kit (Bio‐Rad) or miRCURY LNA Universal RT microRNA PCR system (Exiqon, Euroclone). Amplifications were run on the 7900HT fast real‐time PCR system with an SYBR Master Mix (Bio‐Rad). Data were reported as relative quantity with respect to a calibrator sample using the equation 2−ΔΔCt. The primers used are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!