Sc365546

Manufactured by Santa Cruz Biotechnology

Sc365546 is a laboratory equipment product offered by Santa Cruz Biotechnology. It serves as a core function for scientific research applications. No further details can be provided in an unbiased and factual manner without the risk of extrapolation.

Automatically generated - may contain errors

Lab products found in correlation

Ab181037, by Abcam (3 mentions) Ab32566, by Abcam (2 mentions) 8 well chamber, by Ibidi (1 mentions) Alexa fluor 594 conjugated secondary antibody, by Abcam (1 mentions) 4 6 diamidino 2 phenylindole (dapi), by Merck Group (1 mentions) Meta laser scanning microscope, by Zeiss (1 mentions) Ab2839, by Abcam (1 mentions) Ab172730, by Abcam (1 mentions) Simplechip enzymatic chromatin ip kit, by Cell Signaling Technology (1 mentions) Ne per nuclear and cytoplasmic extraction kit, by Thermo Fisher Scientific (1 mentions) Pvdf membrane, by Merck Group (1 mentions) Ab0049, by Abways (1 mentions) Ab0054, by Abways (1 mentions) Ab89318, by Abcam (1 mentions) Pv 9000, by ZSGB-BIO (1 mentions) Zli 9019, by ZSGB-BIO (1 mentions)

6 protocols using sc365546

DNA Double-Strand Break Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

CC cells were seeded in 8-well chambers (Ibidi, Germany) at a density of 3000 /well. And CC cells were treated with 6 μg/ml CDDP for 1 h for DNA double-strand break staining (γH2AX fluorescence). Target cells were then fixed with 4% polyformaldehyde for 30 min, permeabilized with 0.1% TritonX-100 for 10 min and blocked with 10% BSA for 1 h at room temperature. Blocked cells were incubated overnight with primary antibodies against CEBPD (1:25; sc365546; Santa Cruz), IPO4 (1:50; ab181037; Abcam), γH2AX (1:50; ab2839; Abcam) at 4 °C and then labeled with Alexa Fluor-594-conjugated secondary antibody (1:200) for 1 h at room temperature. While the nuclei were stained for 2 min with DAPI (Sigma, USA). Confocal microscopy (LSM 510, META Laser scanning microscope, Zeiss) was used to acquire images. γH2AX fluorescence was quantitated using ImageJ (NIH, Bethesda, MD).

Zhou Y., Liu F., Xu Q., Yang B., Li X., Jiang S., Hu L., Zhang X., Zhu L., Li Q., Zhu X., Shao H., Dai M., Shen Y., Ni B., Wang S., Zhang Z, & Teng Y. (2020). Inhibiting Importin 4-mediated nuclear import of CEBPD enhances chemosensitivity by repression of PRKDC-driven DNA damage repair in cervical cancer. Oncogene, 39(34), 5633-5648.

+ Open protocol

+ Expand

Immunoprecipitation of CEBPD and IPO4

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein A/G beads were added to the cell lysate with three washes, then beads-lysate complexes were mixed with anti-CEBPD (10 μg; sc-365546; Santa Cruz) or anti-IPO4 antibodies (10 μg; ab181037; Abcam) and rotated overnight at 4 °C with IgG (Abcam, ab172730) as a negative control. Immunoprecipitates were then collected by centrifugation at 3000 × g for further western blotting.

+ Open protocol

+ Expand

ChIP-qPCR Analysis of CEBPD-miR-429 Axis

Check if the same lab product or an alternative is used in the 5 most similar protocols

A SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling) was used for chromatin immunoprecipitation (ChIP) assay. Briefly, fragmented cross‐linked chromatin extracted from cells was immunoprecipitated with primary antibody against CEBPD (Santa Cruz, sc‐365546) and protein G magnetic beads at 4°C. Afterwards, the precipitated DNA was purified from the antibody/protein G complex and was subjected to quantitative RT‐PCR under the thermal cycle: 3 min at 95℃, followed by 40 cycles of 95℃ for 15 s and 60℃ for 1 min. The primers targeting CEBPD‐responsive element binding site on the hsa‐miR‐429 promoter were shown as below: forward: 5′‐GGTTCTTCCCTGGGCTTC‐3′; reverse: 5′‐AGTGTTAGAGTCAAGCTGGGAAAT‐3′.

Chan T., Chen Y., Tan K.T., Wu C., Wu W., Li W., Wang J., Shiue Y, & Li C. (2021). Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis. Clinical and Translational Medicine, 11(12), e674.

+ Open protocol

+ Expand

ChIP Assay Protocol for CEBPD and PRKDC

Check if the same lab product or an alternative is used in the 5 most similar protocols

ChIP assays were done as previously reported [55 (link)]. Antibodies against CEBPD (1:25; sc365546; Santa Cruz) and PRKDC (1:1000; ab32566; Abcam) were used for IP. The primers were listed in Supplementary Table 2.

+ Open protocol

+ Expand

Western Blot Analysis of PRKDC and IPO4

Check if the same lab product or an alternative is used in the 5 most similar protocols

Western blot was performed as previously described [53 (link)]. Antibodies used were rabbit-anti-PRKDC (1:1000; ab32566; Abcam), anti-IPO4(1:1000; ab181037; Abcam), anti-Tubulin (1:3000; ab0049; Abways), anti-laminB (1:5000; ab0054; Abways), mouse anti-CEBPD (1:500; sc365546; Santa Cruz). Notably, PRKDC (450KD) protein was used 6% precast gels with some modifications. Boiling cell lysates were resolved on 6 % precast gels at 150 v for 40 min, then were transferred to a PVDF membrane (Millipore Sigma) using eBlot ® L1 wet transfer system (GenScript, Piscataway, NJ) for 15 min. While others (30–130KD) were used 10% precast gels at 150 v for 40 min and transferred with eBlot ® L1 wet transfer system for 11 min. The Thermo Scientific NE-PER Nuclear and Cytoplasmic Extraction Kit were used to extract the separate cytoplasm and nuclear. Cytoplasmic and nuclear fractionation was done according to the methods described [56 (link)]. Quantitative analysis of protein concentration was calculated using ImageJ (National Institutes of Health).

+ Open protocol

+ Expand

Protein Expression Analysis of CRC CAF Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protein expressions of these CAF signature genes in CRC tissues were analyzed in HPA online database (https://www.proteinatlas.org/), which aims to create a human proteome-wide map through integrated omics technologies [55 (link)].
For markers that are not available in HPA database, IHC will be further applied to examine the protein expression patterns in CRC samples who underwent radical rectal resection in Peking University First Hospital. The research was approved by ethics committee of Peking University First Hospital, and written informed consent was obtained from all subjects. Formalin-fixed paraffin-embedded surgical CRC specimens were collected and incubated with primary antibodies against CEBPD (sc-365546, Santa Cruz Biotechnology Inc., 1:200 dilution) and CXCL1 (ab89318, abcam, 1:200 dilution)) overnight at 4 °C, followed by incubation with secondary antibody (PV-9000, Beijing ZSGB-BIO) at room temperature for 30 min. Then, diaminobenzidine tetrachloride (DAB) staining (10 min at room temperature; ZLI-9019; Beijing ZSGB-BIO) was applied for CEBPD and CXCL1 expressions visualizations.

Zheng H., Liu H., Ge Y, & Wang X. (2021). Integrated single-cell and bulk RNA sequencing analysis identifies a cancer associated fibroblast-related signature for predicting prognosis and therapeutic responses in colorectal cancer. Cancer Cell International, 21, 552.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!