Pei 25000

Manufactured by Polysciences

Sourced in United States

PEI 25000 is a polyethylenimine (PEI) product with an average molecular weight of 25,000 Daltons. PEI is a cationic polymer commonly used in various applications, such as transfection reagents, nanoparticle formation, and gene delivery. The PEI 25000 product provides a source of this widely used polymer for laboratory and research purposes.

Automatically generated - may contain errors

Lab products found in correlation

Lenti x concentrator, by Takara Bio (2 mentions) C2759, by MedChemExpress (2 mentions) Turbofectin, by OriGene (2 mentions) Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (2 mentions) Protein a sepharose cl 4b, by GE Healthcare (1 mentions) Pfuse migg2a fc1 vector, by InvivoGen (1 mentions) Opti mem reduced serum medium, by Thermo Fisher Scientific (1 mentions) Non essential amino acids (neaa), by Merck Group (1 mentions) Dulbecco modified eagle medium (dmem), by Merck Group (1 mentions) Fetal bovine serum (fbs), by Lonza (1 mentions) Hek293t cells, by Polysciences (1 mentions) Mycoplasma detection kit, by Lonza (1 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions) Hek293t, by American Type Culture Collection (1 mentions) Lipofectamine reagent, by Thermo Fisher Scientific (1 mentions) Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions) Lncap, by GeneCopoeia (1 mentions) Rpmi 1640, by HiMedia (1 mentions) Polyvinylidene fluoride (pvdf), by Merck Group (1 mentions) Polybrene, by Merck Group (1 mentions)

15 protocols using pei 25000

Lentiviral Transduction of PDAC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentivirus was produced in HEK293T cells by transfecting plasmid DNA of interest with packaging plasmids (VSVG and psPAX2) using Polyethylenimine (PEI 25000; Polysciences, Cat# 23966-1). Media were replaced 6–8 hrs following transfection. Virus-containing supernatants were then collected every 24 hrs for 48 hrs and filtered through 0.45 μm filter prior to use.
To infect human PDAC cell lines, cell suspensions were mixed with virus-containing supernatants and centrifuged at 600 g for 30 minutes at room temperature. Following centrifugation, cells were plated in tissue culture plates, and virus-containing supernatants were replaced with fresh media after 24 hrs post-infection. To infect human PDAC organoids, virus-containing supernatants were first concentrated 10x using Lenti-X Concentrator (Takara, Cat# 631232). Single cell-suspended organoids were mixed with concentrated virus, supplemented with polybrene to a final concentration of 4 μg/ml, and centrifuged at 800 g for 2 hrs at room temperature. After centrifugation, virus-containing media were removed, and organoids were plated in Matrigel domes supplemented with fresh Human Complete Feeding Media. When selection was used to establish stable cell lines, corresponding antibiotics were added 48 hrs post-infection.

Hur S.K., Somerville T.D., Wu X.S., Maia-Silva D., Demerdash O.E., Tuveson D.A., Notta F, & Vakoc C.R. (2023). p73 activates transcriptional signatures of basal lineage identity and ciliogenesis in pancreatic ductal adenocarcinoma. bioRxiv.

+ Open protocol

+ Expand

Production and Purification of TEM8-Fc Fusion Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genes encoding the human or mouse forms of TEM8 fused to the human Fc protein were cloned into the pFUSE-mIgG2A-Fc1 vector (InvivoGen, San Diego, CA). TEM8 protein production was then carried out with the help of the Protein Expression Facility, University of Birmingham. Human TEM8-Fc/pFUSE-mIgG2A or mouse TEM8-Fc/pFUSE-mIgG2A plasmids were transfected into 293T cells using polyethylenimine (PEI 25000; Polysciences, Warrington, PA) in Opti-MEM Reduced Serum Medium (Gibco) and 7 days later supernatants were harvested and protein purified using Protein A Sepharose CL-4B (GE Healthcare) according to the manufacturer's instructions.

Petrovic K., Robinson J., Whitworth K., Jinks E., Shaaban A, & Lee S.P. (2019). TEM8/ANTXR1-specific CAR T cells mediate toxicity in vivo. PLoS ONE, 14(10), e0224015.

+ Open protocol

+ Expand

HEK293T Cell Culture and Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T cells (HEK 293 T/17, ATCC, CRL-11268) were maintained at 37 °C/5% CO₂ in Dulbecco’s Modified Eagle’s Medium (DMEM, Sigma-Aldrich), supplemented with non-essential amino acids (Sigma, Madrid, Spain) and 10% FBS (Lonza, Madrid, Spain). Cells were transiently transfected with cDNAs using calcium phosphate or PEI 25000 (PolySciences ref: 23966-2).

Alaimo A., Nuñez E., Aivar P., Fernández-Orth J., Gomis-Perez C., Bernardo-Seisdedos G., Malo C, & Villarroel A. (2017). Calmodulin confers calcium sensitivity to the stability of the distal intracellular assembly domain of Kv7.2 channels. Scientific Reports, 7, 13425.

+ Open protocol

+ Expand

PEI-Mediated Transfection of Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were seeded 1 day prior to transfection, and polyethylenimine (PEI 25000 from Polysciences, USA) was used as transfection reagent. Transfection mixture was prepared the following day in 150 mM NaCl solution by mixing DNA and polyethylenimine [DNA (μg):polyethylenimine (μg)] in a ratio of 1:2.4. Transfection mixtures were incubated at room temperature for 15 minutes and then added to the media in dropwise manner.

Manne R.K., Agrawal Y., Bargale A., Patel A., Paul D., Gupta N.A., Rapole S., Seshadri V., Subramanyam D., Shetty P, & Santra M.K. (2017). A MicroRNA/Ubiquitin Ligase Feedback Loop Regulates Slug-Mediated Invasion in Breast Cancer. Neoplasia (New York, N.Y.), 19(6), 483-495.

+ Open protocol

+ Expand

Rab5, EEA1, Rabaptin5, and Rabex-5 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pCDNA-GFP-Rab5 clone was provided by Dr. Yoshikatsu Aikawa at Doshisha University, Japan. The pGEX-EEA1_36-91 clone was obtained from Dr. Bonsu Ku at the Korea Research Institute of Bioscience and Biotechnology (KRIBB). cDNA clones of Rabaptin5 and Rabex-5 were purchased from Open Biosystems. The Rab7 gene was chemically synthesized (Bioneer). Each gene was amplified and cloned into bacterial expression vectors (parallel-His, parallel-GST (Sheffield et al., 1999 (link)), and pQE30) or mammalian expression vectors (pCDNA-FLAG and pCDNA-HA). Human embryonic kidney 293T (HEK 293T) and HeLa cells were purchased from American Type Culture Collection (RRID: CVCL_0063 and CVCL_0030, respectively) and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (heat-inactivated). Plasmids were transfected into cells using Lipofectamine 2000 (Invitrogen) for HeLa cells and PEI 25000 (23966, Polysciences) for HEK 293T cells. Mycoplasma detection kit (LT07-318, Lonza, Switzerland) was regularly used to check absence of mycoplasma.

Shin D., Na W., Lee J.H., Kim G., Baek J., Park S.H., Choi C.Y, & Lee S. (2017). Site-specific monoubiquitination downregulates Rab5 by disrupting effector binding and guanine nucleotide conversion. eLife, 6, e29154.

+ Open protocol

+ Expand

Transfection and Knockdown Techniques

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transfection was performed using Lipofectamine reagent (Invitrogen) or PEI 25000 (Polysciences, Warrington, PA, USA) according to the manufacturer’s protocol. For knockdown experiments, negative control small interfering RNA (siRNA) and C1-Ten siRNA (targeting the C1-Ten sequence TCAGTGGATTACAACATGACA) were used as described previously^{3 (link)}. Cells were transfected with siRNA (100 nM) using Lipofectamine RNAiMAX reagent (Invitrogen) according to the manufacturer’s instructions.

Jeong H., Koh A., Lee J., Park D., Lee J.O., Lee M.N., Jo K.J., Tran H.N., Kim E., Min B.S., Kim H.S., Berggren P.O, & Ryu S.H. (2017). Inhibition of C1-Ten PTPase activity reduces insulin resistance through IRS-1 and AMPK pathways. Scientific Reports, 7, 17777.

+ Open protocol

+ Expand

Overexpression and Silencing of miR-936 in PCa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCa cell lines LNCaP, DU145 and PC-3 were purchased from NCCS Pune (INDIA) and cultured in RPMI-1640 (HiMedia, India) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin, incubated at 37 °C in 5% CO2 with humidified atmosphere. Polyethylenimine (PEI 25000, Polysciences, USA) was used as a transfection reagent, and cells were seeded a day before transfection. Next day, transfection mixture was made in 150 mM NaCl solution by mixing DNA and polyethylenimine in a 1:2.4 ratio [DNA (μg): polyethylenimine (μg)] and the mixtures were incubated at room temperature for 15 min before being added drop-by-drop to the culture medium. MicroRNA expression vector, pCMV-MIR (M1005758 (#SC400690), Origene technology Inc, USA) was used to construct hsa-miR-936 plasmid vector for transfection to produce stable PC-3 cell lines using G-418 selection, subsequently named as miR-PC-3 cells. Synthetic oligonucleotide against hsa-miR-936 (HmiR-AN0841-SN-10, GeneCopoeia, USA) was used to transfect LNCaP cells for neutralizing the endogenous hsa-miR-936.

Edachery S., Patil P., Mohan R., Aradhya B., Shetty J., Kabekkodu S.P., Santra M.K., Gonchigar S.J, & Shetty P. (2022). Loss of miR-936 leads to acquisition of androgen-independent metastatic phenotype in prostate cancer. Scientific Reports, 12, 17070.

+ Open protocol

+ Expand

Lentiviral Transduction of Target Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentivirus was produced by transfecting HEK293T cells with helper plasmids VSVG and psPAX2 (RRID:Addgene_12260) using polyethylenimine (Polysciences, PEI 25000) in a mass ratio of 4:2:3 for plasmid DNA:VSVG:psPAX2. Media was replaced ~6–8 h post transfection, and viral supernatant was collected several times within 24–72 h of transfection. Supernatant was passed through a 0.45 µm PVDF filter before use (Millipore). Lentivirus was added to target cell lines with 8 µg/mL Polybrene (Sigma #H9268) and centrifuged at 650 × g for 25 min at room temperature. Media was changed 15 h post infection. Antibiotics (1 µg/mL puromycin and/or 50 mg/mL G418) were added 15 h post infection when selection was needed.

Gier R.A., Budinich K.A., Evitt N.H., Cao Z., Freilich E.S., Chen Q., Qi J., Lan Y., Kohli R.M, & Shi J. (2020). High-performance CRISPR-Cas12a genome editing for combinatorial genetic screening. Nature Communications, 11, 3455.

+ Open protocol

+ Expand

Cellular Perturbation Assays with Pharmacological Agents

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated for the indicated times with 20 μM CCCP (carbonyl cyanide m-chlorophenyl hydrazone; Sigma-Aldrich, C2759), 10 μM OM (oligomycin A; MedChem Express, HY-16589; Sigma-Aldrich, 75351), 20 μg/mL cycloheximide (Sigma-Aldrich, C4859), 10 μM tunicamycin (MedChem Express, HY-A0098), 200 nM ISRIB (Sigma-Aldrich, SML0843).
Cells were plated 24 h before transfection with polyethylenimine (PEI 25000, Polysciences) or turbofectin (OriGene Technologies). Cells were treated, harvested, passaged or placed on selection medium 24 h after transfection.
Transfections of siRNAs (siNTC, D-001810-10-05, Horizon Discovery; siTOMM40, M-012732-00-0010, Horizon Discovery; siTIMM23, 1299001, Thermo Fisher Scientific) were performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) following the manufacturer’s instructions.
For induction of shRNAs from the pLKO vector, cells were treated with 500 ng/mL doxycycline hyclate (Biomol, Cay14422-1) for 5 days.
For growth assays, cells were counted and seeded at equal numbers in triplicate wells on day 0 in DMSO (control) or 200 nM ISRIB-containing medium. Cells were passaged every 2–3 days and counted using Countess® Cell Counting Chamber Slides (Thermo Fisher Scientific, C10228). Counts shown in bar graphs represent the ratio of ISRIB-treated cells versus DMSO-treated controls.

Fessler E., Krumwiede L, & Jae L.T. (2022). DELE1 tracks perturbed protein import and processing in human mitochondria. Nature Communications, 13, 1853.

+ Open protocol

+ Expand

Lentiviral Transduction of PDA Cells and Organoids

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentivirus was produced in HEK 293 T cells by transfecting plasmid DNA and packaging plasmids (VSVG and psPAX2) using Polyethylenimine (PEI 25000; Polysciences; Cat# 23966–1). Media were replaced with target media 6–8 hr following transfection and lentivirus-containing supernatant was subsequently collected every 12 hr for 48 hr prior to filtration through a 0.45 μm filter. For infection of human PDA cells, cell suspensions were mixed with lentiviral-containing supernatant supplemented with polybrene to a final concentration of 4 μg/ml. Cells were plated in tissue culture plates of the appropriate size and lentiviral-containing supernatant was replaced with fresh media after an incubation period of 24 hr. For infection of pancreatic organoids, lentivirus was first concentrated 10x in mouse organoid media (Boj et al., 2015 (link)) using Lenti-X concentrator according to the manufacturer’s instructions. Organoid cultures were then dissociated into single cells, and spinoculated by centrifugation as described previously (Roe et al., 2017 (link)).

Somerville T.D., Biffi G., Daßler-Plenker J., Hur S.K., He X.Y., Vance K.E., Miyabayashi K., Xu Y., Maia-Silva D., Klingbeil O., Demerdash O.E., Preall J.B., Hollingsworth M.A., Egeblad M., Tuveson D.A, & Vakoc C.R. (2020). Squamous trans-differentiation of pancreatic cancer cells promotes stromal inflammation. eLife, 9, e53381.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!