SiRNA duplexes were designed and synthesized by Integrated DNA Technologies (Coralville, IA, USA). Sequences of siRNA are listed in Supplementary Table S3 . Cells were transfected with 100 pmol SiRNA duplexes by Lipofectamine 2000 (Thermo Fisher Scientific). Forty-eight hours after transfection, cells were used for ZIKV infection at MOI of 10:1. Viral RNA expression was measured by quantitative RT-PCR 24 hours thereafter.
Sirna duplexes
Manufactured by Integrated DNA Technologies
Sourced in United States
SiRNA duplexes are short, double-stranded RNA molecules designed to target and silence specific genes within cells. They function by binding to and degrading the corresponding mRNA, thereby preventing the production of the targeted protein.
Automatically generated - may contain errors
Lab products found in correlation
Lipofectamine 2000, by Thermo Fisher Scientific (3 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (3 mentions)
Complete edta free protease inhibitor tablet, by Roche (1 mentions)
Bca assay, by Thermo Fisher Scientific (1 mentions)
Odyssey imaging system, by LI COR (1 mentions)
Rnaimax, by Thermo Fisher Scientific (1 mentions)
B 5 1 2, by Merck Group (1 mentions)
Sirna duplexes, by Polyplus Transfection (1 mentions)
Phorbol myristate acetate (pma), by Merck Group (1 mentions)
Tib 202, by American Type Culture Collection (1 mentions)
Sirna duplexes, by RiboBio (1 mentions)
Pgl3b, by Promega (1 mentions)
Hiperfect transfectant, by Qiagen (1 mentions)
Endotoxin free purification system, by Qiagen (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Penicillin, by GE Healthcare (1 mentions)
Streptomycin, by GE Healthcare (1 mentions)
9 protocols using sirna duplexes
1
siRNA Knockdown of ZIKV Infection
2
Verification of EFR3A Antibody Specificity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The specificity of the EFR3A antibody (Ab2, Sigma) was verified by Western blot analysis of HeLa cell lysates treated with siRNA duplexes (Integrated DNA Technologies, Coralville, IA, USA) targeted against human EFR3A or negative control siRNA, termed NC1. The siRNA sequences are shown in Additional file 10 : Table S5. HeLa cells were transfected with the appropriate siRNA duplex (from a 20 μM stock in 30 mM HEPES (4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid, N-(2-Hydroxyethyl)piperazine-N´-(2-ethanesulfonic acid)), 100 mM potassium acetate) using RNAiMAX (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, and after 6 hr, the media was exchanged for regular growth media. After 3 days, the cells were collected, dissolved in lysis buffer (1% Triton X-100, 150 mM NaCl, 20 mM Tris, 0.5 mM EDTA, pH 7.4, supplemented with Complete EDTA-free protease inhibitor tablet (Roche)), centrifuged for 10 min at 16,000 g, and the supernatant was reserved. Protein concentrations were normalized using the BCA assay (Thermo Pierce). The samples were analyzed by Western blot (50 μg sample/lane), probing with anti-EFR3A (Ab2, Sigma) or anti-α-tubulin (B-5-1-2, Sigma) antibodies. IRDye 800CW-conjugated anti-rabbit and anti-mouse secondary antibodies (LI-COR Biosciences) were used, and the Western blots were scanned on an Odyssey imaging system (LI-COR Biosciences).
3
Silencing PHD Expression in 832/13 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of PHD was suppressed in 832/13 cells by the introduction of siRNA duplexes (Integrated DNA Technologies, Coralville, IA). Three independent siRNA sequences were designed per PHD isoform (see Table 1 ). A previously used scrambled siRNA sequence (GAG ACC CUA UCC GUG AUU A) with no known target was used as a control (siCtl) (Pillai et al. 2011 ). siRNA duplexes were introduced into 832/13 cells at 40–50% confluence using INTERFERin nucleofection (Polyplus Transfection, New York, NY). RNA isolation and real‐time PCR was performed as described earlier (Patterson et al. 2014 ).
4
siRNA-Mediated Knockdown of DDR1 in Cell Culture
5
Macrophage Differentiation and Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human monocyte-like THP-1 cells (TIB-202; ATCC) were cultured in RPMI medium containing 10% FBS and then differentiated into macrophages through exposure to 5 ng/mL Phorbol 12-Myristate 13-Acetate (PMA) (Sigma-Aldrich) for 2 days. The murine macrophage cell line RAW264.7 (TIB-71; ATCC) was cultured in DMEM containing 10% FBS. All siRNA duplexes were purchased from Integrated DNA Technologies (Coralville, IA). PMA-differentiated THP-1 macrophages and RAW264.7 cells were transfected with scrambled (Scr) siRNA or siRNAs specific for target genes for 48 h with Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA). For overexpression, RAW264.7 cells were infected with an empty vector control virus or an adenovirus carrying the human TonEBP gene at a multiplicity of infection of 50 for 24 h.
6
Gene Silencing Using siRNA Duplexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene silencing, small interfering RNA (siRNA) duplexes targeting the mouse gene were synthesized by Integrated DNA Technologies. The siRNA duplexes for mouse lincRNA-Cox2 knock down using the following oligos: 5′-GCCCUAAUAAGUGGGUUGUUU-3′ (sense sequence). The siRNA duplexes for mouse Atg5, Nlrp3, Asc, Casp1, Trif, and a siRNA-control were purchased from RiboBio (Guangzhou, China). The cells were treated with siRNAs (final concentration, 25 nM) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions and were harvested 24 h after siRNA treatment. Quantitative RT-PCR and western blot was used to determine the significant expression changes for each target gene.
7
Macrophage Regulation of IL-10 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All siRNA duplexes were purchased from Integrated DNA Technologies (Coralville, IA, USA). Primary human macrophages and RAW264.7 cells were transfected with concentration-matched pairs of scrambled siRNA or siRNA against target genes using HiPerFect transfectant (Qiagen, Valencia, CA, USA) as previously described51 (link) and lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions, respectively. For overexpression, RAW264.7 cells were infected with the empty control virus (Ad-EV) or the adenovirus carrying the human TonEBP gene (Ad-TonEBP). A 1.6-kb fragment of the mouse IL-10 promoter (−1538/+64 pGL2B) and its 5′ deletion mutants were obtained from Addgene Inc. (Cambridge, MA, USA) and were subcloned into pGL3B (Promega, Madison, WI, USA). Sp1- or C/EBP-binding sites in −688/+64 promoter were mutated by a two-step PCR procedure using overlapping internal primers that contain a mutant sequence as published previously29 (link). All plasmids were purified using an endotoxin-free purification system (Qiagen) and transfected using lipofectamine 2000 (Invitrogen).
8
siRNA Knockdown of Cell Cycle Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
siRNA duplexes were purchased from Integrated DNA Technologies. These were: Negative control, CCNE1 siRNA1: sense sequence 5′-GAUCAGCACUUUCUUGAGCAACACC −3′, anti-sense sequence 3′- CCCUAGUCGUGAAAGAACUCGUUGUGG −5’; CCNE1 siRNA 2: sense sequence 5′- AUGCAAAAGGUUUCAGGGUAUCAGT −3′, anti-sense sequence 3′- ACUACGUUUUCCAAAGUCCCAUAGUCA −5′, CCNE2 siRNA 1: sense sequence 5′- CAUUCUGACUUGGAACCACAGAUGA −3′, anti-sense sequence 3′- ACGUAAGACU GAACCUUGGUGUCUACU −5’; CCNE2 siRNA 2: sense sequence 5′- ACGUAAGACUGAACCUUGGUGUCUACU −3′, anti-sense sequence 3′- AGUCAGGAACGUAAUAGUAACUUUGUG −5′ and c-Myc siRNA 1: sense sequence 5′- AUCAUUGAGCCAAAUCUUA AAAAAA −3′, anti-sense sequence 3′- UAUAGUAACUCGGUUUAGAAUUUUUUU −5’; c-Myc siRNA 2: sense sequence 5′- CGAC GAGACCUUCAUCAAAAACATC −3′, anti-sense sequence 3′- CUGCUGCUCUGGAAGUAGUUUUUGUAG −5’. For knockdown experiments, MCF-7 cells mixed with a combination of 20 nM siRNA duplexes were transfected 24 h before live-cell experiments.
9
Cell Culture Protocol for HEK293T and U2OS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T and U2OS cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific Inc., Waltham, MA, USA), 100 U/ml penicillin, and 100 μg/ml streptomycin (GE Healthcare Life Sciences, Logan, UT, USA). Cells were maintained at 37°C in an incubator with 5% of CO2. Antibodies used for immunoblotting or immunoprecipitation were obtained from various companies. Cells were transfected with Lipofectamine 2000 or Lipofectamine RNAimax (Invitrogen, Carlsbad, CA, USA). siRNA duplexes were purchased from Integrated DNA Technologies (Coralville, IA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!