Mastercycler realplex2 system

mRNA samples were isolated from mouse testes using Tri-Reagent (Molecular Research Center, Cincinnati, OH) and reverse transcribed using the Verso cDNA synthesis Kit (Thermo Fisher Scientific, Waltham, MA). For quantitative PCR, primers were designed using online software (Roche, Basel, Switzerland) and probes were purchased from Universal ProbeLibrary (Roche). Roche 480 LightCycler (Roche) was used for probe-based real-time PCR. GoTaq qPCR master mix (Promega, Madison, WI) was used for experiments using BRYT dye on the Mastercycler RealPlex² system (Eppendorf, Westbury, NY). The relative fold change in gene mRNA level was calculated by the comparative cycle threshold (2^–ΔΔCt) method using 18S rRNA for normalization of the expression data. Primer sequences are shown in Table 1. The number of animals used in each group is shown in figure legends.

For the determination of RNA levels by reverse transcription-quantitative PCR (RT-qPCR), P. aeruginosa strains were grown with the indicated concentrations of either arabinose (depletion experiments) or antibiotics for either 4 or 6 h. RNA was then prepared from these cultures using the hot acid phenol procedure as described above. Primers were designed by the use of the GenScript real-time PCR primer design tool. cDNA was synthesized with a SuperScript III first-strand synthesis system for reverse transcription-PCR (Invitrogen) and random hexamer primers. RT-qPCR was carried out using PerfeCTa SYBR green FastMix (Quanta Biosciences) in a Mastercycler Realplex2 system from Eppendorf. Changes in transcript levels relative to the levels in the untreated control cultures were calculated. Growth and compound exposures for RNA extractions for the RT-qPCR experiments were performed twice (biological replicates) on different days.

Cells were harvested in mid-log phase, resuspended in 1 ml of TRIzol (Invitrogen), and incubated for 5 min at room temperature before the addition of 200 μl of chloroform. Samples were centrifuged at 13,000 relative centrifugal force (rcf) for 10 min. The aqueous phase was mixed with 200 μl of 100% ethanol, and the mixture was transferred to Purelink RNA Mini columns (Invitrogen) for purification following the manufacturer’s instructions. RNA was treated with Turbo DNase (Invitrogen) according to the manufacturer’s instructions. The KAPA SYBER FAST One-Step quantitative reverse transcription-PCR (qRT-PCR) kit (Kapa Biosystems) was used to measure mRNA abundance on the Eppendorf Mastercycler RealPlex2 system. Relative gene expression changes were calculated using the Livak method (55 (link)). The primers used for the detection of hcp-1 and ctxA are listed in Table S5. The reference gene used was gyrA.

For determination of RNA levels by quantitative PCR (qPCR), various concentrations of antibiotic were first tested in cultures grown in 20-ml volumes. The concentrations of antibiotics that were twice the lowest level required to inhibit growth, determined by measurement of the optical density (see Fig. S1 in the supplemental material), were selected, and in a subsequent experiment cells were incubated with those concentrations for 30 min. RNA was then prepared from these cultures with the hot acid phenol procedure as described above. Primers were designed by use of the GenScript real-time PCR primer design tool. cDNA was synthesized with a SuperScript III first-strand synthesis system for reverse transcription-PCR (Invitrogen) and random hexamer primers. The qPCR was carried out using PerfeCTa SYBR Green FastMix (Quanta Biosciences) in a Mastercycler Realplex² system from Eppendorf. Changes in transcript levels relative to the levels in the untreated control cultures were calculated. The growth and exposure for RNA extractions for the qPCR experiments with 30-min compound exposures were performed twice (biological replicates) on different days.

PBMC DNA was extracted using a phenol-chloroform protocol [40 ]. Extracted DNA was analyzed on the NanoDrop ND-1000 spectrophotometer for purity evaluation (260/280) and quantification.
For Leishmania infantum parasitic load quantification, qPCR was used, employing primers that amplify the intergenic spacer internal transcript (ITS1) segment of the parasite rRNA gene at a concentration of 10mM (5’TCCAGCACATTTTGCGA GTA3’ and 5’CCACACAGGTTTCTTCTTTATTTGG3’) [41 (link)]. qPCR reaction was standardized with 30 ng purified genomic DNA, 12.5 μL SYBR Green JumpStart Taq ReadyMix (Sigma-Aldrich, St. Louis, MO, USA), 5 pmol of each primer, and 9.5 μL of ultrapure H₂O in a final reaction volume of 25 μL. We also generated a ten-fold standard curve using extracted DNA from Leishmania infantum promastigotes (MHOM/BR00/MER02) for parasite quantification. Reactions were performed using a Mastercycler RealPlex2 system (Eppendorf, CT, USA) under the following conditions: Initial heating of 94°C for 2 min, followed by 40 cycles of denaturation (94°C for 15 s), annealing, and extension (58°C for 1 min). After these steps, a dissociation curve of the amplified fragment was determined (95°C for 15 s, then 60°C to 95° C at 15 s/°C). Parasitic DNA load was determined in each sample by comparing each sample to the standard curve.