Testing for SARS-CoV-2 was performed by real-time RT-PCR method. Four hundred micro litre of each of the Sigma Virocult swabs with added 5 µL internal control were extracted using the Kingfisher Flex system (ThermoFisher, UK) with elution volume of 50 µL. Ten micro liter of extracted sample material was then added to 15 µL PCR master mix of the CE-marked Bosphore Novel Coronavirus (2019-nCoV) Detection v2 Kit (manufactured by Anatolia Geneworks, Turkey and supplied by Launch Diagnostics, UK). This is then amplified on the Applied Biosystems 7500 machine (Applied Biosystems, USA) using the thermal protocol for Bosphore Novel Coronavirus (2019-nCoV) Detection Kit v2 as per manufacturer recommendation. The targets for the test include (orf1ab & Egene). The manufacturer reported 100% specificity and 95% sensitivity (with analytical detection limit of 25 copies/rxn).
Applied biosystems 7500 machine
Manufactured by Thermo Fisher Scientific
Sourced in United States, China
The Applied Biosystems 7500 is a real-time PCR instrument designed for a variety of applications, including gene expression analysis, genotyping, and viral detection. The system features a 96-well block format and can perform simultaneous detection of multiple targets. It is compatible with a range of chemistry options and offers intuitive software for data analysis and reporting.
Automatically generated - may contain errors
Lab products found in correlation
Reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Superscript vilo synthesis kit, by Thermo Fisher Scientific (2 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
Fast sybr green master mix, by Roche (2 mentions)
Maxima h minus first strand cdna synthesis kit with dsdnase, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Kingfisher flex system, by Thermo Fisher Scientific (1 mentions)
Quantifast multiplex rt pcr kit, by Qiagen (1 mentions)
Qiaamp viral rna kit, by Qiagen (1 mentions)
Sybr green, by Takara Bio (1 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Dnase 1 treated, by Thermo Fisher Scientific (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (1 mentions)
Sybr green qpcr master mix, by Vazyme (1 mentions)
Hifair 2 1st strand cdna synthesis supermix, by Yeasen (1 mentions)
11 protocols using applied biosystems 7500 machine
1
SARS-CoV-2 Detection by Real-Time RT-PCR
2
Quantitative RT-PCR for HCoV-OC43 Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from 140 μl of the raw nasopharyngeal sample using QIAamp Viral RNA kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer’s protocol. The nucleic acid extracts were screened for HCoV-OC43 using a Quantifast Multiplex RT-PCR Kits (Qiagen) run on an Applied Biosystems 7500 machine (version 2.5, Applied Biosystems, Foster City, CA, USA) (Hammitt et al. 2012 (link)). The HCoV-OC43 primers and probe targeted the 1a gene region (encoding RdRp) (Gunson, Collins, and Carman 2005 (link)). Samples were deemed HCoV-OC43 positive if an amplification cycle threshold (Ct) of <35.0 was observed.
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA were extracted from the single lymphocyte suspension. The cDNA was obtained using the reverse transcription kit (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time PCR was performed with SYBR Green (Takara, Madison, WI, USA) on the Applied Biosystems 7500 machine (Applied Biosystems, Foster City, CA, USA). Primer sequences were as follows: ROR, forward 5′-GAACCAGAACAGGGTCCAGA-3′ and reverse 5′-TCGGAAGGACTTGCAGACAT-3′; Foxp3, forward 5′-ACTCGCATGTTCGCCTACTT-3′ and reverse 5′-GTCCACACTGCTCCCTTCTC-3′; and IL-17, forward 5′-TCCCTCTGTGATCTGGGAAG-3′ and reverse 5′-CTCGACCCTGAAAGTGAAG-3′. The reaction conditions consisted of 50 °C for 2 min, 95 °C for 30 s, followed by 95 °C for 5 s, 62 °C for 34 s, for totally 40 cycles. Relative expression levels of target genes were calculated.
4
Quantitative PCR for AMPA Receptor Subunits
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cell culture using RNeasy Micro Kit (QIAGEN) and cDNA was subsequently generated using Superscript Vilo Synthesis Kit (Invitrogen) according to manufacturer’s manuals. qPCR was run on Applied Biosystems 7500 machine (Life Technologies) using Fast SYBR Green Master Mix (Roche). Primers used in this study are:
GRIA1_F: acgGTTTGGGATATTCAACAGTTTGTGGTTCTC
GRIA1_R: cgtGACCTGGGAGAAATGTCACATCCTT
GRIA2_F: cgaTAAAGAGTTTTTCAGGAGAT
GRIA2_R: cgtCAGAGGGCTCCGCACTCCGCATGT
GRIA3_F: cgaCCATCAGCATAGGTGGACTTTTCAT
GRIA3_R: tcgGTTGTATAACTGCACGGCAAAGC
GRIA4_F: cgaCTAGAAAGGTTGGTTACTGGAATGATATG
GRIA4_R: cgtGCTGTGTCATTGCCAAGAGTT
5
Quantitative RT-PCR Protocol for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using TRI reagent (Sigma) and DNase I-treated (Ambion). cDNA was synthesized using a Maxima first strand cDNA synthesis kit (Fermentas). qRT –PCR was performed using Quantace Sensimix on an Applied Biosystems 7500 machine (Life Technologies Corporation). Primer pairs were previously published (Molkentin et al. 1997 (link); Fujikura et al. 2002 (link); Niwa et al. 2005 (link); Brown et al. 2010a (link)) or designed using Primer3 software. All primers are listed in Supplemental Table S6.
6
Quantitative PCR analysis of gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted by TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA), and the cDNA synthesis was performed by Maxima H Minus First Strand cDNA synthesis kit (Thermo Fisher Scientific, Waltham, MA, USA). qPCR was performed on an Applied Biosystems 7500 machine (Life Technologies) using ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech, Nanjing, China). The relative expression of GAPDH mRNA is the relative mRNA expression level of genes, and the data of all genes are shown as fold change against controls. Data are expressed as mean ± standard deviation (SD) and all experiments have been repeated at least 3 times. All relevant PCR primers are summarized in Table 1 .
The Primers of Genes for qPCR
| Target Genes | Forward Primers | Reverse Primers |
|---|---|---|
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
| STAT3 | CAATACCATTGACCTGCCGAT | GAGCGACTCAAACTGCCCT |
| IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| IL-1β | GCAACTGTTCCTGAACTCAACT | ATCTTTTGGGGTCCGTCAACT |
| TNFα | CTGAACTTCGGGGTGATCGG | GGCTTGTCACTCGAATTTTGAGA |
| CCR5 | TTTTCAAGGGTCAGTTCCGAC | GGAAGACCATCATGTTACCCAC |
| CXCL10 | CCAAGTGCTGCCGTCATTTTC | GGCTCGCAGGGATGATTTCAA |
7
Senescent Fibroblast RNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA of young and senescent fibroblasts was collected using TRIzol (Invitrogen). 2 μg RNA was used for reverse transcription (Maxima H Minus First Strand cDNA Synthesis Kit with dsDNase, ThermoScience, K1682, United States), and gene expression was analyzed using an Applied Biosystems ® 7,500 machine (Life Technologies, United States). The primers were shown in Table 1 .
8
Quantitative PCR for AMPA Receptor Subunits
9
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in cells and tissue samples was extracted using the standard RNA extraction method with TRIzol (Invitrogen Life Technologies, USA). After a NanoDrop spectrophotometer determined RNA concentration, reverse transcription was performed on 2 μg RNA, using the Maxima H Minus First-Strand cDNA Synthesis Kit with dsDNase (Thermo Scientific, K1682, USA) to synthesize the cDNA strand, and gene expression was analyzed using an Applied Biosystems ® 7500 machine (Life Technologies, USA) with the qPCR SYBR Green Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China). The primers are shown in Table S11
10
Quantitative Analysis of Osteogenic Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Trizol reagent (Takara Japan Bio Co. Ltd., Japan) and reverse-transcribed using the PrimeScript RTMaster Mix (Takara Japan Bio Co. Ltd.). The primer sequences are listed in Supplementary Table 1 . The mRNA expression of housekeeping gene glyceraldehyde-3-phosphate dehydrogenase, as well as that of target genes encoding MGP, Wnt3a, β-catenin, and Runx2 was determined using the SYBR Premix Ex Taq II (Takara Japan Bio Co. Ltd.) on an Applied Biosystems 7500 machine (Thermo Fisher Scientific, Waltham, MA, USA). The polymerase chain reaction conditions were as follows: 95°C for 30 s for stage 1; 40 cycles of 95°C for 5 s and 64°C for 34 s for stage 2. The expression of target genes was normalized to that of glyceraldehyde-3-phosphate dehydrogenase. The relative expression was calculated using the formula 2−ΔΔCt.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!