Mrna isolation kit

Total RNA was isolated from powdered roots according to Woodrow et al. (2016 (link)). RNA quantity and quality were determined spectrophotometrically using the NanoDrop ND-1000 UV-VIS (Thermo Scientific, Wilmington, MA) and separated on 1.5% agarose gel stained with SYBR safe (Invitrogen). mRNA was purified from ~500 μg of total RNA using a mRNA Isolation Kit (Roche) following manufacturer's instructions. First strand cDNA was synthesized from 1 μg of mRNA by reverse transcriptase with both random hexamer primers and anchored oligo dT according to the instructions of the SensiFAST^™ cDNA Synthesis Kit (Bioline).

mRNA was isolated from OVCAR3 cells (obtained from ATCC) using an mRNA isolation kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions. The cDNA was synthesized from 500 ng mRNA using Maxima First Strand cDNA Synthesis Kit for RT-PCR, with dsDNase (Thermo Fisher Scientific, Waltham, MA, USA), following the manufacturer’s instructions. The predicted DNA sequence of the SEA11-12 domain of MUC16 was obtained from the NCBI (GenBank Accession #: AF414442 and NM_024690). The following primers were used to amplify the coding sequence with overhangs for Gibson assembly into a custom vector pMUFV01-Fc.

HB103 (5′ to 3′)

GCATTGCACTAAGTCTTGCACTTGTCACGAATTCGATAAATGGTTTCACCCAGCGG

HB104 (5′ to 3′)

GGCATGTGTGAGTTTTGTCAGATCTAACCATGGCCGATGATAAATTCTGGGGTGCATAGC

This vector (Supplementary Figure S1) is a lentiviral compatible vector that contains a strong EF alpha promoter and encodes proteins with IL2 secretion signal and C-terminal Fc fusion.

We homogenized larval gut samples using a pestle and mortar in the presence of liquid nitrogen. Following the manufacturer’s instructions, polyadenylated RNA was extracted using the mRNA Isolation Kit (Roche Molecular Biochemicals). We quantified the concentration of mRNA using the Qubit fluorometer (Invitrogen).

To compare the expression of the PGIP genes between the three plant lines with respect to the treatments (feeding vs. control), RT‐qPCR was performed. RNA was extracted from leaves that were damaged by feeding P. cochleariae and from the undamaged leaves of control plants. We followed the protocol for extraction and RT‐qPCR as described above with some modifications. RNA was enriched for messenger RNA (mRNA) for reverse transcription to remove traces of genomic DNA from RNA extractions by using the mRNA Isolation Kit (Roche Diagnostics GmbH) according to the manufacturer's instructions. 100 mg of leaf material was used for mRNA enrichment. The RT‐qPCR program was as follows: 95°C for 15 min, then 40 cycles at 95°C for 15 s, 56°C for 30 s, and 72°C for 30 s, and afterward a melt cycle from 55 to 95°C in 0.5‐s increments. Ubiquitin‐conjugating enzyme 21 (UBC21; NM_001036862) was used as a reference gene, and quantities of the genes of interest were expressed as RNA molecules of GOI/1000 RNA molecules of UBC21. The Cq values were determined from two technical replicates of each of the three biological replicates.