Sybr green pcr master mix

All real-time qPCR was performed using SYBR Green PCR Master Mix (BIOFACT, Republic of Korea) on a Step One Plus™ Real-Time PCR System (Applied Biosystems, USA). The reactions were amplified for 15 min at 95 °C, followed by 40 cycles of 95 °C for 20 s, 59–60 °C for 30 s and 72 °C for 15 s. The PCR products of the miRNAs and genes were checked on 3% and 1% agarose gels, respectively. Reactions were performed on three biological (RNA) and three technical replicates. Normalized expression levels of the miRNAs and genes were calculated with 2^−ΔΔCt method using U6 and MEP as the internal control, respectively. The data were analyzed according to [100 (link)].

For total RNA extraction using the TRIzol reagent (Invitrogen, USA, Cat. No.: 15596-026), tissues samples were homogenized (MM400 homogenizer, Retsch, Germany), and total RNA was extracted, according to the manufacturer's recommendations. The quality of extracted RNA was measured by determining the absorbance ratio at 260 and 280 nm (A_260/280). Total complementary DNA (cDNA) was synthesized using the RevertAid^TM First-Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). Also, microRNA cDNA was generated by a microRNA cDNA synthesis kit (ParsGenome, Iran). The primer sequences were as follows: PPARγ (forward): 5′-CCT CAT GAA GAG CCT TCC AAC-3′ and PPARγ (reverse): 5′-ACC CTA GCA TCC TTC ACA AGC-3′; GAPDH (forward): 5′-CTG CTC CTC CTG TTC GAC AGT-3′ and GAPDH (reverse): 5′-CCG TTG ACT CCG ACC TTC AC-3′.
The qRT-PCR assay was performed using the SYBR Green PCR Master Mix (BioFact, Korea) and microRNAs (ParsGenome, Iran) in a Corbett Rotor-Gene 6000 machine (Sydney, Australia). GAPDH [22 ] and U6 snRNA were used as internal controls to normalize the mRNA and miR expression levels, respectively. The following cycling program was used in this study: five minutes at 95 °C, followed by 40 cycles at 95 °C for 5 s, at 62 °C for 20 s, and at 72 °C for 30 s. Duplicate reactions were performed for each sample.

The major sites of microbial fermentation, propagation, and colonization of enteropathogens in the monogastric are the ileum, which is why in this study the population of E. coli was analyzed only in the ileum section. The entire ileum digesta was taken and mixed and 100 mg of the digesta was used for the DNA extraction using QIAamp DNA Stool Mini Kit (Germany). The quantitative real-time PCR was applied using the SYBR Green PCR Master Mix (Biofact, Korea). The fold changes for the E. coli in the ileum digesta was determined using the 2^−∆∆Ct method as described earlier [35 , 36 (link)]. The primer used in this study are study are E. coli (O157:H7) ( F: ttaccagcgataccaagagc; R: caacatgaccgatgacaagg) [37 ] and Total bacteria (F: cggcaacgagcgcaaccc; R: ccattgtagcacg tgtgtagcc) [38 (link)].

Twenty-four hours after treatments, the total RNA extraction was performed using RiboEx LS RNA (GeneAll Biotech, Seoul, Korea). Then, the cDNA of samples was obtained from RNAs using the cDNA synthesis kit (BioFact, Daejeon, Korea) to measure the expression of target mRNAs. Then, the qRT-PCR was performed with a standard SYBR Green PCR master mix (BioFact, Daejeon, Korea) protocol in the StepOnePlus real-time PCR. The GAPDH gene was used as a reference gene for SOX-2, CD44, ROCK1, MMP9, caspase-9, -8, -3, and Bcl-2 genes. The primer sequences used in this study are shown in Table 3. The relative expression levels of target genes were normalized to internal controls using the 2^−ΔΔCt cycle threshold method.