Log In Sign up
The largest database of trusted experimental protocols

Discover sc single cell kit

Manufactured by Vazyme
Visit Supplier

The Discover-sc Single Cell Kit is a laboratory tool designed for the isolation and processing of single cells. It provides a platform for the preparation of single-cell samples for downstream analysis, such as transcriptome profiling.

Automatically generated - may contain errors

Lab products found in correlation

Pmd18 t vector, by Takara Bio (1 mentions) Aria 2 sorter, by BD (1 mentions) Acidic tyrode s solution, by Solarbio (1 mentions)

Spelling variants of this product

Discover-sc® Single Cell WGA Kit (2 citations)

6 protocols using discover sc single cell kit

1

Single-cell DNA extraction and amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The genomic DNA of cells harvested from FACS was extracted using QuickExtract DNA Extraction Solution (Lucigen) according to the manufacturer’s protocols. The genomic DNA of zygotes was amplified using the Discover-sc Single Cell Kit (Vazyme, N601-01) according to the manufacturer’s protocols. The target sequences were amplified and sequenced using the primers listed in Table S3.
Liu X., Li G., Zhou X., Qiao Y., Wang R., Tang S., Liu J., Wang L, & Huang X. (2019). Improving Editing Efficiency for the Sequences with NGH PAM Using xCas9-Derived Base Editors. Molecular Therapy. Nucleic Acids, 17, 626-635.
+ Open protocol
+ Expand
2

Profiling T-cell receptor repertoire

Check if the same lab product or an alternative is used in the 5 most similar protocols
Individual iT lymphocytes were sorted into PBS using AriaII sorter (BD Biosciences). The single cell genome was amplified by Discover-sc single cell kit according to manufacturer's protocols (N601-02, Vazyme Biotech Co., Ltd). PCR for detecting TCRβ V(D)J rearrangements was performed as described 10 (link),43 (link) using the following primers: Vβ2 (upstream): GGGTCACTGATACGGAGCTG, Vβ4 (upstream): GGACAATCAGACTGCCTCAAGT, Vβ5.1 (upstream): GTCCAACAGTTTGATGACTATCAC, Vβ8 (upstream): GATGACATCATCAGGTTTTGTC, and jβ2 (downstream): TGAGAGCTGTCTCCTACTATCGATT. After 35 cycles of amplification (15 sec at 95°C, 20 sec at 60 °C, 1 min at 72 °C), PCR products were purified and cloned into pMD18-T vector (6011, TaKaRa). To confirm the identities of the PCR products, three clones of each recombinant were sequenced. The specific V(D)J rearrangements were further aligned by Igblast tool (https://www.ncbi.nlm.nih.gov/igblast) 44 (link).
Zhang M., Dong Y., Hu F., Yang D., Zhao Q., Lv C., Wang Y., Xia C., Weng Q., Liu X., Li C., Zhou P., Wang T., Guan Y., Guo R., Liu L., Geng Y., Wu H., Du J., Hu Z., Xu S., Chen J., He A., Liu B., Wang D., Yang Y.G, & Wang J. (2018). Hoxb5 reprograms B cells into functional T lymphocytes. Nature immunology, 19(3), 279-290.
+ Open protocol
+ Expand
3

Single-Cell Ig Heavy Chain Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Semi-nested PCR for detecting Ig heavy chain V(D)J rearrangement was performed as described 18 (link). For single cell analysis, individual cells were sorted into PBS, lysed and subsequently amplified by Discover-sc single cell kit according to manufacturer’s protocols (N601-02, Vazyme Biotech Co., Ltd). Amplification processes were carried out in two rounds: I, containing following 5’primers (VHJ558, 5'-ARGCCTGGGRCTTCAGTGAAG-3'; VHQ52, 5'-GCGAAGCTTCTCACAGAGCCTGTCCATCAC-3'.) and the JH4E primer (5'-AGGCTCTGAGATCCCTAGACAG-3'), 200 ng DNA template, and with a 60 °C annealing/30s extension, and 20 cycle program; II, 0.25 μl first round product was diluted and used as template. Then 35 cycles of amplification were performed with either primer pairs VHJ558 and the nested JH4A (5'-GGGTCTAGACTCTCAGCCGGCTCCCTCAGGG-3'), or primer pairs VHJ558 and the nested JH4A as described 18 (link).
Zhang M., Dong Y., Hu F., Yang D., Zhao Q., Lv C., Wang Y., Xia C., Weng Q., Liu X., Li C., Zhou P., Wang T., Guan Y., Guo R., Liu L., Geng Y., Wu H., Du J., Hu Z., Xu S., Chen J., He A., Liu B., Wang D., Yang Y.G, & Wang J. (2018). Hoxb5 reprograms B cells into functional T lymphocytes. Nature immunology, 19(3), 279-290.
+ Open protocol
+ Expand
4

Single-Cell Transcriptome Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The collected embryos and blastomeres were amplified using Discover-sc Single Cell Kit (Vazyme, N601-01). The product was diluted 100-fold before it was used as the template to amplify the target sites.
Li G., Liu X., Huang S., Zeng Y., Yang G., Lu Z., Zhang Y., Ma X., Wang L., Huang X, & Liu J. (2019). Efficient Generation of Pathogenic A-to-G Mutations in Human Tripronuclear Embryos via ABE-Mediated Base Editing. Molecular Therapy. Nucleic Acids, 17, 289-296.
+ Open protocol
+ Expand
5

Genetic Editing of Human Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
The immature oocytes were cultured in maturation medium (Cooper Surgical/SAGE, Trumbull, CT, USA) supplemented with 75 mIU/mL follicle-stimulating hormone (FSH) and luteinizing hormone (LH). The mature oocytes fertilized with the MFS patient’s sperm using ICSI. 16–18 hr later, the fertilization was confirmed by formation of two pronuclei. The concentrations of BE3 mRNA and sgRNA were adjusted to 100 and 50 ng/μL as previously reported.17 (link) Microinjection was performed using an inverted microscope equipped with a microinjector and micromanipulators. The corrected embryos will be cultured for 2 days using standard procedures. Then these embryos were digested using acidic Tyrode’s solution (Solarbio, Beijing, China). The collected embryos were amplified using Discover-sc Single Cell Kit (N601-01; Vazyme) to obtain enough DNA for genotype identification.
Zeng Y., Li J., Li G., Huang S., Yu W., Zhang Y., Chen D., Chen J., Liu J, & Huang X. (2018). Correction of the Marfan Syndrome Pathogenic FBN1 Mutation by Base Editing in Human Cells and Heterozygous Embryos. Molecular Therapy, 26(11), 2631-2637.
+ Open protocol
+ Expand
6

Single-Cell Whole Genome Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Single cells or single spheres were sucked up by a micro-pipette. Whole genome amplification (WGA) was performed to these cells using the Discover-sc Single Cell Kit (Vazyme, Cat. N601-01) according to the manufacturer’s manual, and a reaction of human tissue genomic DNA was marked as a positive control. The amplified DNA products were then stored at − 20 °C.
Tong M., Deng Z., Yang M., Xu C., Zhang X., Zhang Q., Liao Y., Deng X., Lv D., Zhang X., Zhang Y., Li P., Song L., Wang B., Al-Dherasi A., Li Z, & Liu Q. (2018). Transcriptomic but not genomic variability confers phenotype of breast cancer stem cells. Cancer Communications, 38, 56.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!