Exicycler 96 quantitative real time pcr system

The effect of CRE and CSE extracts was determined by using real-time PCR. B16F10 cells were stimulated with 1 μM of α-MSH in the presence of each ethanol extract for 48 h. Total RNA was isolated using Ribozol™ reagent (AMRESCO) following the manufacturer's instructions. Reverse transcription and cDNA amplification was carried out with 1 μg of isolated RNA using AccuPower^® RT premix. Real-time PCR was performed using an Exicycler™ 96 Quantitative Real-Time PCR System (Bioneer, Korea). The reaction was cycled 40 times for GAPDH, MITF, tyrosinase, TRP-1 and TRP-2 for 10 min at 95 °C, 15 s at 95 °C and 30 s at 56–58 °C. The primers used for quantitative real-time PCR were as follows: for GAPDH (133 bp) 5′ CTTTGTCAAGCTCATTTCCTGG 3’ (forward) and 5′ TCTTGCTCA GTGTCCTTGC 3’ (reverse); for MITF (116 bp) 5′AGGACCTTGAAAACCGACAG 3’ (forward) and 5′ GGTGGATGGGATAAGGGAAAG 3’ (reverse); for tyrosinase (150 bp) 5′ CTAACTTACTCAGCCCAGCATC 3’ (forward) and 5′ GGGTTTTGGCTTTGTCATGG 3’ (reverse); for TRP-1 (134 bp) 5′AGCCCCAACTCTGTCTTTTC 3’ (forward) and 5′ GGTCTCCCTACATTTCCAGC 3’ (reverse); for TRP-2 (135 bp) 5′ TCCAGAAGTTTGACAGCCC 3’ (forward) and 5′ GGAAGGAGTGAGCCAAGTTATG 3’ (reverse). The fold change in mRNA levels was calculated using the ΔΔct method (2^−ΔΔct) for relative quantification between samples and control.

The RAW 264.7 cells were treated with HJ extract for 1 h, and then stimulated with LPS or vehicle for 24 h. The total RNA from the cells was extracted and the samples were reverse transcribed using the iScript cDNA synthesis kit (BioRad, Hercules, CA, USA). The resulting cDNA was amplified using the Exicycler 96 quantitative Real-Time PCR system and SYBR Premix Ex Taq (both from Bioneer, Daejeon, Korea) according to the manufacturer's instructions. Oligonucleotide primers [for TNF-α, IL-1β, IL-6, cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS)] were designed by Primer Express 3.0 software (Applied BioSystems, Carlsbad, CA, USA); the primer sequences used in the experiments are listed in Table I. The cycling conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, and 60°C for 1 min. To detect and remove possible primer-dimer artifacts, a dissociation curve was generated for the following cycling conditions: 95°C for 15 sec, 60°C for 1 min, and 95°C for 15 sec. The results were normalized to 18s mRNA levels (reference gene).