Insect High Five cells (Invitrogen) were cultured at 28°C in Express Five serum-free medium (SFM, Invitrogen) containing L-glutamine (Invitrogen). The cells were cotransfected with the EGFP, EGFP-Tube, or EGFP-ΔTube plasmid and the synthesized miR-217 (miR-217-mimic) using the Cellfectin transfection reagent (Invitrogen) according to the protocol of the manufacturer. The concentrations of miR-217-mimic and the plasmid were 200 nM/well and 400 ng/well, respectively. As a control, the control miRNA was included in the cotransfection. All the miRNAs were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). At 48 h after cotransfection, the EGFP fluorescence of the cells was measured by a Flex Station II microplate reader (Molecular Devices, USA) at 490/510 nm of excitation/emission (Ex/Em).
Flex station 2 microplate reader
Manufactured by Molecular Devices
Sourced in United States
The Flex Station II microplate reader is a versatile instrument designed for a wide range of assays. It is capable of fluorescence, absorbance, and luminescence measurements. The Flex Station II can accommodate microplates with 6 to 384 wells, providing flexibility for various experimental needs.
Automatically generated - may contain errors
Lab products found in correlation
Cellfectin transfection reagent, by Thermo Fisher Scientific (3 mentions)
High five insect cells, by Thermo Fisher Scientific (3 mentions)
L glutamine, by Thermo Fisher Scientific (3 mentions)
Cellfectin 2 reagent, by Thermo Fisher Scientific (3 mentions)
Ros assay kit, by Beyotime (2 mentions)
Express five, by Thermo Fisher Scientific (2 mentions)
Express five serum, by Thermo Fisher Scientific (1 mentions)
Fluorescence microscopy, by Zeiss (1 mentions)
Piz egfp v5 his vector, by Thermo Fisher Scientific (1 mentions)
Inverted fluorescence microscope, by Leica camera (1 mentions)
Mitosox red mitochondrial superoxide indicator, by Thermo Fisher Scientific (1 mentions)
Drosophila schneider 2 cells, by Thermo Fisher Scientific (1 mentions)
Flipr calcium 5 assay kit, by Molecular Devices (1 mentions)
14 protocols using flex station 2 microplate reader
1
Cotransfection of miR-217 and EGFP Plasmids
2
Measuring Mud Crab Oxidative Stress
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ROS levels in mud crabs were detected by a reactive oxygen species (ROS) assay kit (Beyotime, China) according to the manufacturer’s instructions. Briefly, mud crab hemocytes were harvested and resuspended in ice-cold acid citrate dextrose (ACD) anticoagulant buffer (1.32% sodium citrate, 0.48% citric acid, and 1.47% glucose) supplemented with 0.1% DCFH-DA (2,7-dichlorodihydrofluorescein diacetate) at 37°C for 20 min. Then, the cells were washed three times with ACD anticoagulant buffer. Finally, a Flex Station II microplate reader (Molecular Devices, USA) was used to examine the ROS levels at excitation/emission (Ex/Em) of 488/525 nm, pictures were captured by fluorescence microscopy (Carl Zeiss, German), and the cell numbers of each sample were counted with an optical microscope and hemacytometer.
3
Fluorescence-Based Aptamer-Target Interactions
4
Monitoring EGFP-STAT Overexpression in Insect Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Insect High Five cells (Invitrogen, USA) were cultured at 28 °C in Express Five serum-free medium (Invitrogen) containing l -glutamine (Invitrogen). When the cells reached 70–80% confluence, they were transfected with 6 μg of EGFP, EGFP-STAT, EGFP-∆STAT-9041, or EGFP-∆STAT-9850. Simultaneously, the cells were transfected with 300 nM of synthesized miR-9041, synthesized miR-9850, or synthesized control miRNA. All the miRNAs were synthesized by Shanghai Gene Pharma Co., Ltd. (Shanghai, China). The transfection reactions were performed in triplicate with Cellfectin transfection reagent (Invitrogen) according to the manufacturer’s protocol. After 12 h of incubation, the transfected cells were seeded into 96-well plates at a concentration of 2.0 × 104 cells per well. At 48 h after transfection, the fluorescence of the cells was examined with a Flex Station II microplate reader (Molecular Devices, USA) at 490/510 nm for excitation and emission (Ex/Em), respectively. The fluorescence values were corrected by subtracting the autofluorescence of cells that did not express EGFP. All the experiments were biologically replicated three times.
5
Investigating miR-7 and CLTC1 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the interaction between miR-7 and shrimp CLTC1 gene, fluorescence assays were performed in insect High Five cells. The shrimp CLTC1 and the enhanced green fluorescent protein (EGFP) genes were cloned into a pIZ/EGFP V5-His vector (Invitrogen, USA) using gene-specific primers (5′- AATTC CGCCTGGCTCAGAACT-3′ and 5′-GTAGTACAGTTCAATGTTGGCAAC-3′ ) to make EGFP-CLTC1 construct. As a control, the seed sequence of shrimp CLTC1 was randomly mutated and cloned into pIZ/EGFP V5-His vector using primers 5′- AATTCCGCCTGGCTCAGAACT-3′ and 5′- TCTGGTCCAGGGTTAACGCCTT A -3′ to construct EGFP-CLTC1-mutant. When the High Five cells were at about 70% confluence, they were cotransfected with the miR-1 precursor (30 nM) and a plasmid containing the EGFP gene or EGFP-CLTC1 or EGFP-CLTC1-mutant (2 µg/mL) using Cellfectin transfection reagent according to the manufacturer's protocol (Invitrogen, USA). At 48 h after transfection, the fluorescence of the cells was monitored with a Flex Station II microplate reader (Molecular Devices, USA) at 490 and 510 nm for excitation and emission. The fluorescence values were corrected by subtracting the autofluorescence of cells not expressing EGFP. All the experiments were repeated biologically three times.
6
Quantifying miRNA-mRNA Interactions in Insect Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture, transfection and fluorescence assays were carried out as described previously (19 (link)). Insect High Five cells (Invitrogen, USA) were cultured in a 96-well plate with Express Five serum-free medium (SFM) (Invitrogen, USA) containing L-glutamine (Invitrogen, USA) at 27°C. The cells in each well were co-transfected with 0.2 μg of the constructed plasmids and 100 nM of miR-1000 or miR-1000-scrambled with Cellfectin II Reagent (Invitrogen, USA) according to the manufacturer's instructions. All the miRNAs were synthesized by Shanghai GenePharma (Shanghai, China). At 48 h after the co-transfection, the fluorescence intensity of cells was determined using a Flex Station II microplate reader (Molecular Devices, USA) at 490/510 nm excitation/emission (Ex/Em). Based on the fluorescence values of the cells co-transfected with miR-1000 and EGFP-wsv191-3′UTR, EGFP-wsv407-3′UTR or EGFP-wsv024-3′UTR, the relative fluorescence intensity was calculated. This assay was biologically repeated for three times.
7
Quantifying HA-β2AR Expression in HEK293 Cells
8
Mud Crab Hemocyte ROS Measurement
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5 mL hemolymph from three randomly chosen mud crabs per group were drawn into tubes containing ACD anticoagulant buffer, and then centrifuged immediately at 800 ×g for 20 min at 4°C to isolate the hemocytes. Next, flow cytometry method was used to measure cellular ROS level with a ROS Assay Kit (Beyotime Biotechnology, China). For mitochondrial ROS measurement, the ROS intensity was analyzed by MitoSOX Red Mitochondrial Superoxide Indicator (Invitrogen, USA). The fluorescence in hemocytes was observed using an inverted fluorescence microscope (Leica, Germany) and measured by a Flex Station II microplate reader (Molecular Devices, USA).
9
Drosophila S2 Cell Transfection Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Drosophila Schneider 2 (S2) cells (Invitrogen) were cultured in Express Five serum-free medium (SFM) (Invitrogen) at 27ºC. The EGFP-PDCD6 or EGFP-ΔPDCD6 plasmid (100 ng/well) and the synthesized miR-9875 (miR-9875-scrambled) (50 nM/well) were co-transfected into S2 cells using the Cellfectin II Reagent (Invitrogen, USA). After 48 h of co-transfection, the EGFP fluorescence of S2 cells was measured by a Flex Station II microplate reader (Molecular Devices, USA) at 490/510 nm of excitation/emission (Ex/Em).
10
Calcium Signaling Assay for CXCR1/2 Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human Embryonic Kidney 293 (HEK293) cells stably expressing Gα16 and CXCR1 or CXCR2 were seeded onto 96-well plates and incubated for 24 h. Cells were loaded with 2 μmol L−1 Fluo-4 AM in Hanks balanced salt solution (HBSS, containing KCl 5.4 mmol L−1, Na2HPO4 0.3 mmol L−1, KH2PO4 0.4 mmol L−1, NaHCO3 4.2 mmol L−1, CaCl2 1.3 mmol L−1, MgCl2 0.5 mmol L−1, Mg2SO4 0.6 mmol L−1, NaCl 137 mmol L−1, BSA 5 g L−1, glucose 5.6 mmol L−1, and sulfinpyrazone 250 μmol L−1, at pH 7.4) at 37 °C for 45 min. The excess dye was removed and 50 μL of the HBSS containing test compounds was added. After incubation at room temperature for 10 min, 25 μL HBSS containing IL-8 was dispensed into the well using a FlexStation II microplate reader (Molecular Devices, Sunnyvale, CA, USA) and the intracellular calcium change was recorded with an excitation wavelength of 485 nm and emission wavelength of 525 nm. The half maximal inhibitory concentrations (IC50) of compounds were determined using the “Analyze Data” “XY analyses” “Nonlinear regression (curve fit)” protocol implanted in GraphPad Prism software by constructing their dose–response curves, where the x axis is the log value of concentration and the y axis is the response value (for the curves of each compound, see Table S1† ). Each experiment was repeated at least three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!