Log In Sign up
The largest database of trusted experimental protocols

Roche480ii lightcycler

Manufactured by Roche
Visit Supplier

The Roche480II Lightcycler is a real-time PCR instrument designed for quantitative analysis of nucleic acids. It utilizes fluorescence-based detection technology to measure the amplification of target sequences during the PCR process. The instrument provides precise temperature control and automated data analysis to support research and diagnostic applications.

Automatically generated - may contain errors

Lab products found in correlation

Protoscript m mulv first strand cdna synthesis kit, by New England Biolabs (4 mentions) Rneasy mini kit, by Qiagen (4 mentions) Tissueruptor, by Qiagen (2 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Nucleospin soil kit, by Macherey-Nagel (1 mentions) Sybr green, by Roche (1 mentions) Protoscript first strand cdna synthesis kit, by New England Biolabs (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Rneasy plus kit, by Qiagen (1 mentions)

8 protocols using roche480ii lightcycler

1

Quantifying Gut Microbiome Profiles

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
After the 4-day regimen, fecal pellets were collected and stored at −80°C until analysis. DNA was extracted using a standard phenol:chloroform extraction method, as described previously.22 (link) Real-time quantitative polymerase chain reaction amplification of 16S ribosomal RNA (rRNA) was performed with a Roche 480 II Light Cycler (Roche, Indianapolis, IN). 16S rRNA gene-specific primers were used to target specific bacterial genera; 16S rRNA (forward: 5′-ATG GYT GTC GTC AGC TCG TG-3′ (reverse: 5′-GGG TTG CGC TCG TTG C-3′). Genes were quantified by determining a standard curve for gene copy number by cloning primer sequences into pCR4-TOPO plasmids and gene copy number was determined from stool as described previously.23 (link),24 (link)
Sato H., Zhang L.S., Martinez K., Chang E.B., Yang Q., Wang F., Howles P.N., Hokari R., Miura S, & Tso P. (2016). Antibiotics Suppress Activation of Intestinal Mucosal Mast Cells and Reduce Dietary Lipid Absorption in Sprague-Dawley Rats. Gastroenterology, 151(5), 923-932.
+ Open protocol
+ Expand
2

Extraction and Analysis of RNA from Murine Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
2mm colonic tissue, and 25mg heart, liver, lung, and MLN were washed and cut open (when appropriate), then suspended in 700uL of RLT buffer (Mini RNeasy Kit) and homogenized using TissueRuptor (Qiagen). RNA was then isolated using the RNeasy Mini Kit (Qiagen). As per manufacturer’s instructions, DNase treatment was performed using RNeasy DNase kit (Qiagen) and protocol. cDNA synthesis was performed using ProtoScript M-MuLV First Strand cDNA synthesis kit (New England Biolabs) and Random Primers. qPCR was performed on a Roche480II Lightcycler using the following primers: Gapdh forward 5′tggccttccgtgttcctac 3′, Gapdh reverse 5′ gagttgctgttgaagtcgca3′, Mx2 forward 5′ccagttcctctcagtcccaagatt 3′, and Mx2 reverse 5′tactggatgatcaagggaacgtgg 3′, OasL2 forward 5′ggatgcctgggagagaatcg 3′, and OasL2 reverse 5′tcgcctgctcttcgaaactg 3′. Relative expression of the respective genes to Gapdh expression was calculated using the ΔΔCT method and values were expressed as fold change normalized to uninfected WT mice.
Martin P.K., Marchiando A., Xu R., Rudensky E., Yeung F., Schuster S.L., Kernbauer E, & Cadwell K. (2018). Autophagy proteins suppress protective type I interferon signaling in response to the murine gut microbiota. Nature microbiology, 3(10), 1131-1141.
+ Open protocol
+ Expand
3

Quantifying Fungal Abundance in Fecal Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fungal DNA was isolated from individual fecal pellets using the NucleoSpin Soil kit (Macherey-Nagel) as described in 16S library preparation. Quantitative PCR was performed using SybrGreen (Roche) on a Roche480II Lightcycler. See Key Resource Table for full primer sequences. Relative abundance of fungal-specific internal transcribed spacer (ITS) rDNA was calculated using the ΔCT method and the values were converted as fold change from the average CT of control lab mice samples.
Yeung F., Chen Y.H., Lin J.D., Leung J.M., McCauley C., Devlin J.C., Hansen C., Cronkite A., Stephens Z., Drake-Dunn C., Fulmer Y., Shopsin B., Ruggles K.V., Round J.L., Loke P., Graham A.L, & Cadwell K. (2020). Altered immunity of laboratory mice in the natural environment is associated with fungal colonization. Cell host & microbe, 27(5), 809-822.e6.
+ Open protocol
+ Expand
4

Quantifying Gene Expression in Organoids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from organoids at day 2 after lentiviral transduction or at day 3 after crypt dissemination for Lgr5 with TRIzol Reagent (Invitrogen) and cDNA was synthesized using ProtoScript First Strand cDNA Synthesis kit (NEB) according to the manufacturer’s protocol. Quantitative PCR was performed on a Roche 480 II LightCycler. Gene expression was normalized to Gapdh using the following primers: Ripk3, 5′-AGGCTTCTAAAGCGAGTGATGT-3′ and 5′-TGAAGTCTTGTCTACCAACTCAGC-3′; Atg7, 5′-CAGTTTCCAGTCCGTTGAAGTCCT-3′ and 5′-GGGTCCATACATCCACTGAGGTTC-3′; Lgr5, 5′-CCTACTCGAAGACTTACCCAG-3′ and 5′-GCATTGGGGTGAATGATAGCA-3′; and Gapdh, 5′-TGGCCTTCCGTGTTCCTAC-3′ and 5′-GAGTTGCTGTTGAAGTCGCA-3′.
Matsuzawa-Ishimoto Y., Shono Y., Gomez L.E., Hubbard-Lucey V.M., Cammer M., Neil J., Dewan M.Z., Lieberman S.R., Lazrak A., Marinis J.M., Beal A., Harris P.A., Bertin J., Liu C., Ding Y., van den Brink M.R, & Cadwell K. (2017). Autophagy protein ATG16L1 prevents necroptosis in the intestinal epithelium. The Journal of Experimental Medicine, 214(12), 3687-3705.
+ Open protocol
+ Expand
5

Extraction and Analysis of RNA from Murine Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
2mm colonic tissue, and 25mg heart, liver, lung, and MLN were washed and cut open (when appropriate), then suspended in 700uL of RLT buffer (Mini RNeasy Kit) and homogenized using TissueRuptor (Qiagen). RNA was then isolated using the RNeasy Mini Kit (Qiagen). As per manufacturer’s instructions, DNase treatment was performed using RNeasy DNase kit (Qiagen) and protocol. cDNA synthesis was performed using ProtoScript M-MuLV First Strand cDNA synthesis kit (New England Biolabs) and Random Primers. qPCR was performed on a Roche480II Lightcycler using the following primers: Gapdh forward 5′tggccttccgtgttcctac 3′, Gapdh reverse 5′ gagttgctgttgaagtcgca3′, Mx2 forward 5′ccagttcctctcagtcccaagatt 3′, and Mx2 reverse 5′tactggatgatcaagggaacgtgg 3′, OasL2 forward 5′ggatgcctgggagagaatcg 3′, and OasL2 reverse 5′tcgcctgctcttcgaaactg 3′. Relative expression of the respective genes to Gapdh expression was calculated using the ΔΔCT method and values were expressed as fold change normalized to uninfected WT mice.
Martin P.K., Marchiando A., Xu R., Rudensky E., Yeung F., Schuster S.L., Kernbauer E, & Cadwell K. (2018). Autophagy proteins suppress protective type I interferon signaling in response to the murine gut microbiota. Nature microbiology, 3(10), 1131-1141.
+ Open protocol
+ Expand
6

Quantifying Intestinal Gene Expression and Pathogens

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from colonic tissue was isolated using Trizol and standard protocols, followed by cDNA synthesis using ProtoScript M-MuLV First Strand cDNA synthesis kit (New England Biolabs) and OligodTs. qPCR was performed on a Roche480II Lightcycler using the following primers: Gbp2 (Fwd 5′-TGCTAAACTTCGGGAACAGG-3′, Rev 5′-GAGCTTGGCAGAGAGGTTTG-3′), IL-10 (Fwd 5′-GCCGTCATTTTCTGCCTCAT-3′; Rev 5′-GCTTCCCTATGGCCCTCATT-3′), IFN-γ (Fwd 5′-ATGAACGCTACACACTGCATC-3′; Rev 5′-CCATCCTTTTGCCAGTTCCTC-3′), Gapdh (Fwd 5′-TGCCCCCATGTTTGTGATG-3′, Rev 5′-TGTGGTCATGAGCCCTTCC-3′). Relative expression of the respective genes to Gapdh expression was calculated using the ΔΔCt method and values were expressed as fold change from ABX treated mice. Total RNA from stool was isolated with Trizol followed by cDNA synthesis with random hexamer primers for quantification of C. rodentium virulence factor expression with the following primers ler (Fwd 5′-AATATACCTGATGGTGCTCTTG-3′, Rev 5′-TTCTTCCATTCAATAATGCTTCTT-3′), tir (Fwd 5′-TACACATTCGGTTATTCAGCAG-3′, Rev 5′-GACATCCAACCTTCAGCATA-3′) and recA (Fwd 5′-CGCATTCGCTTTACCCTGACC-3′, Rev 5′-TCGTCGAAATCTACGGACCGGA-3′).
Kernbauer E., Ding Y, & Cadwell K. (2014). An enteric virus can replace the beneficial function of commensal bacteria. Nature, 516(7529), 94-98.
+ Open protocol
+ Expand
7

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
For bulk RNA-seq and qPCR, RNA was isolated using RNeasy plus kit (QIAGEN) following the vendor’s instructions and quantified using NanoDrop-8000 spectrometer. For qPCR, RT was performed using High-Capacity cDNA Reverse Transcription Kit (Thermofisher). RT conditions were as follows: 25°C for 10 min, 37°C for 120 min, 85°C for 5 min. qPCR was performed on a Roche 480 II Lightcycler, using gene-specific FAM-labelled TaqMan probes, GAPDH, ABL1 and CASC3 as internal controls. qPCR conditions were as follows: 95°C for 10 min, 45 cycles of (95°C for 20 s, 60°C for 1 min). Biological replicates (3 to 6) were included for all conditions and three technical replicates were used during qPCR.
Zhang S., Zhang H., Forrest M.P., Zhou Y., Sun X., Bagchi V.A., Kozlova A., Santos M.D., Piguel N.H., Dionisio L.E., Sanders A.R., Pang Z.P., He X., Penzes P, & Duan J. (2023). Multiple genes in a single GWAS risk locus synergistically mediate aberrant synaptic development and function in human neurons. Cell Genomics, 3(9), 100399.
+ Open protocol
+ Expand
8

Quantifying Intestinal Gene Expression and Pathogens

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from colonic tissue was isolated using Trizol and standard protocols, followed by cDNA synthesis using ProtoScript M-MuLV First Strand cDNA synthesis kit (New England Biolabs) and OligodTs. qPCR was performed on a Roche480II Lightcycler using the following primers: Gbp2 (Fwd 5′-TGCTAAACTTCGGGAACAGG-3′, Rev 5′-GAGCTTGGCAGAGAGGTTTG-3′), IL-10 (Fwd 5′-GCCGTCATTTTCTGCCTCAT-3′; Rev 5′-GCTTCCCTATGGCCCTCATT-3′), IFN-γ (Fwd 5′-ATGAACGCTACACACTGCATC-3′; Rev 5′-CCATCCTTTTGCCAGTTCCTC-3′), Gapdh (Fwd 5′-TGCCCCCATGTTTGTGATG-3′, Rev 5′-TGTGGTCATGAGCCCTTCC-3′). Relative expression of the respective genes to Gapdh expression was calculated using the ΔΔCt method and values were expressed as fold change from ABX treated mice. Total RNA from stool was isolated with Trizol followed by cDNA synthesis with random hexamer primers for quantification of C. rodentium virulence factor expression with the following primers ler (Fwd 5′-AATATACCTGATGGTGCTCTTG-3′, Rev 5′-TTCTTCCATTCAATAATGCTTCTT-3′), tir (Fwd 5′-TACACATTCGGTTATTCAGCAG-3′, Rev 5′-GACATCCAACCTTCAGCATA-3′) and recA (Fwd 5′-CGCATTCGCTTTACCCTGACC-3′, Rev 5′-TCGTCGAAATCTACGGACCGGA-3′).
Kernbauer E., Ding Y, & Cadwell K. (2014). An enteric virus can replace the beneficial function of commensal bacteria. Nature, 516(7529), 94-98.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!