To validate whether the RNA-seq results were reliable, the relative expression levels of four identified DEGs, lipoprotein lipase (LPL), troponin C1, slow skeletal and cardiac type (TNNC1), fatty acid binding protein 4, adipocyte (FABP4), and parvalbumin (PVALB), were verified using quantitative real-time PCR (qRT-PCR). The primers were designed using Primer Premier 6 (PREMIER Biosoft, San Francisco, CA, United States) (Table 1 ), and the β-actin gene was used as a housekeeping gene to standardize the levels of gene expression. The cDNA amplifications used PrimerScript RT reagent kits (Takara, Kyoto, Japan) with gDNA Erase (Takara, Kyoto, Japan), according to the manufacturer’s instructions. The qPCR reaction contained 2 µl of cDNA, 0.8 µl of each forward and reverse primers (10 um/ul), 10 µl of TB GreenTM Premix Ex Taq II (Takara, Kyoto, Japan), 6 µl of RNAase free water, and 0.4 µl of ROX Reference Dye II (50×). The qPCR reaction used an Aligent Mx3000P system (Agilent Technologies, Santa Clara, CA, United States), and a two-step amplification method: 1) a pre-degeneration of 15 s at 95°C; and 2) 5 s at 95°C and 34 s at Tm for 40 cycles. Cycle threshold (CT) values were recorded and relative expressions were determined according to the 2-△△ct method (Livak and Schmittgen, 2001 (link)).
Gdna erase
Manufactured by Takara Bio
Sourced in China
GDNA Erase is a solution designed to remove genomic DNA (gDNA) from RNA samples. It efficiently eliminates gDNA contamination, ensuring the purity of RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Primerscript rt reagent kit, by Takara Bio (4 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Tb green premix ex taq 2, by Takara Bio (1 mentions)
Primer premier 6, by Premier Biosoft (1 mentions)
Primescript rt kit, by Takara Bio (1 mentions)
Sybr premix ex tag, by Takara Bio (1 mentions)
Ex taq, by Takara Bio (1 mentions)
Superreal premix, by Tiangen Biotech (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex tag, by Bio-Rad (1 mentions)
Rneasy plant mini kit, by Takara Bio (1 mentions)
Cfx96, by Bio-Rad (1 mentions)
9 protocols using gdna erase
1
Validation of RNA-seq Differential Gene Expression
2
RNA Isolation and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total tissue and cellular RNA were isolated using TRIZOL (Life Technologies). DNA was removed, and PrimeScript RT kits and gDNA Erase (Takara) were used for cDNA synthesizing. Premix Ex Taq II was regarded to determine the relative gene expression. Gene expression was quantified using the primers listed in Table S1 . GAPDH and hypoxanthine phosphoribosyltransferase was used as endogenous control, and mRNA expression was calculated by the ΔΔCt method to evaluate mRNA expression ploidy changes. All ploidy changes were normalized to those of the untreated control.
3
RNA Extraction and qPCR Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The root, stem, leaf, petiole and receptacle samples stored at − 80 °C were used for total RNA extraction with a modified CTAB method [80 ].The cDNA was generated by Primerscript RT reagent Kit with gDNA Erase (Takara) according to the manufacturer’s protocol. Quantitative PCR (qPCR) was performed using SYBR Premix Ex Tag (Takara), with GAPDH as an internal reference gene [81 (link)]. Results were analyzed using the 2-ΔCT method [81 (link)]. Three biological and three technical replicates were performed and analyzed. Primers used in this study are listed in Additional file 12 .
4
Gene Expression Analysis in Jaw Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from jaws preserved with RNAlater according to the manufacturer’s instructions, and cDNAs were synthesized by using a PrimeScript RT reagent Kit with gDNA Erase (TaKaRa). RT-PCR analysis was performed by using EX Taq (TAKARA) according to the manufacturer’s instructions. The sequences of the primers were as follow: fkbp5f, TGTCCAGGGTTTGATGTGGA; fkbp5r, GTTCTTTGCGTTCCCGACTG; ddit4f, GTCCAACAATGGCAGCAGAA; ddit4r, TTCCTCCAGTGGGTCAAAGAA; gapdhf, CTTGGATACACAGAGGACCAGG; and gapdhr, GCCAAACTCATTATCGTACCAT.
5
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fat body tissues were lysed using TRIzol reagent (Invitrogen), and total RNA was extracted according to a protocol described previously [50 (link)]. Then, single-stranded cDNA was synthesized using PrimeScript RT reagent Kit with gDNA Erase (TaKaRa) starting from 1 μg total RNA. The qRT-PCR of target genes was performed using SuperReal PreMix (Tiangen) in a StepOnePlus Fast Real-Time PCR system (Thermo Fisher Scientific), and each reaction was run in triplicate. Template concentration was normalized to an endogenous control ribosomal protein S7 (RPS7). The primers used for qRT-PCR are listed in the S1 Table .
6
Validation of Differentially Expressed Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To test selected gene expression differences which had been identified by the RNA-seq analysis, the expressions of four candidate genes, namely, UCP1, RYR1 (ryanodine receptor 1), ADIPOQ and LPL (lipoprotein lipase) were analyzed using an RT-qPCR approach. The primers for RT-qPCR validation were designed using Oligo7 (Wojciech Rychlik, USA) (Table 1 ), with β-actin as a reference gene to verify the relative level of expression. The RT-qPCR amplification of cDNA pools used a PrimerScript RT reagent kit (Takara) with gDNA Erase (Takara), according to the manufacturer’s instructions. The RT-qPCR reactions used an Agilent Mx3000P system (Mx3000P, Stratagene, Agilent, Santa Clara, CA, USA), and reactions contained 2 µL of cDNA, 0.8 µL forward and reverse primers (10 uM), 10 µL TB GreenTM Premix Ex Taq II, 6 µL RNAase free water, and 0.4 µL ROX Reference Dye II (50×) in a total volume of 20 µL. The thermal profile for amplification followed a two-step approach: 1) pre-denaturation for 15 s at 95 °C; then 2) 5 s at 95 °C and 34 s at the Tm listed in Table 1 for 40 cycles. Changes in gene expressions were determined by the 2−△△ct method [20 (link)].
7
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an RNeasy Plant Mini Kit (Takara, Dalian, Liaoning, China). Extracted RNA was treated with RNase-Free DNAse according to the manufacturer’s instructions. Total DNA-free RNA was used as a template for cDNA synthesis, using the Primerscript RT Reagent Kit (Takara, Dalian, Liaoning, China) with gDNA Erase (Takara, Dalian, Liaoning, China). For real-time quantitative PCR, SYBR Premix Ex Tag was used on a Bio-Rad CFX96 (Bio-Rad, Shanghai, China) instrument. PCR reactions were performed in a 96-well iCycler. The melting temperature of the products was determined to verify the specificity of the amplified fragments. The sequences of primers used for real-time quantitative PCR are listed in Supplementary Table 1 . Results were analyzed by the ΔΔCT method using SlActin as the control locus. All real-time quantitative PCR data points were the average of three biological replicates, and three technical replicates.
8
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated by using TRIzol (Invitrogen) and Reverse transcription was performed with 2 µg of total RNA using by gDNA Erase and PrimeScript RT reagent kits (TAKARA Biotechnology, Dalian, China) following with the manufacturer's instructions, respectively. SYBR Green PCR master mix was employed for mRNA quanti cation. GAPDH was used as a control gene. The primer sequences are as follows: SETD1A: forward, 5'-TTGCCATGTCAGGTCCAAAAA-3', reverse, 5'-CGTACTTACGGCACATATCCTTC-3'; CYR61: forward, 5'-GATCTGCAGAGCTCAGTCAG-3', reverse, 5'-GCACTGCCCGGTAACTTTGA-3'; CTGF: forward, 5'-TGCCCTCGCGGCTTACCGAC-3', reverse, 5'-TGCAGGAGGCGTTGTCATTG-3'; β-actin: forward, 5'-AGCGAGCATCCCCCAAAGTT-3', reverse, 5'-GGGCACGAAGGCTCATCATT-3'.
9
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated by using TRIzol (Invitrogen) and Reverse transcription was performed with 2 μg of total RNA using by gDNA Erase and PrimeScript RT reagent kits (TAKARA Biotechnology, Dalian, China) following with the manufacturer's instructions, respectively. SYBR Green PCR master mix was employed for mRNA quanti cation. GAPDH was used as a control gene. The primer sequences are as follows: SETD1A: forward, 5'-TTGCCATGTCAGGTCCAAAAA-3', reverse, 5'-CGTACTTACGGCACATATCCTTC-3'; CYR61: forward, 5'-GATCTGCAGAGCTCAGTCAG-3', reverse, 5'-GCACTGCCCGGTAACTTTGA-3'; CTGF: forward, 5'-TGCCCTCGCGGCTTACCGAC-3', reverse, 5'-TGCAGGAGGCGTTGTCATTG-3'; β-actin: forward, 5'-AGCGAGCATCCCCCAAAGTT-3', reverse, 5'-GGGCACGAAGGCTCATCATT-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!