The largest database of trusted experimental protocols

Tnt t7 sp6 kit

Manufactured by Promega

The TnT T7/SP6 kit is a cell-free, in vitro transcription and translation system used to produce proteins from DNA templates. The kit contains the necessary components, including RNA polymerase, ribonucleotides, and amino acids, to enable the direct conversion of DNA into functional proteins.

Automatically generated - may contain errors

Lab products found in correlation

2 protocols using tnt t7 sp6 kit

1

Protein-DNA Binding Assay with Radiolabeled Probes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant proteins were synthesized using a coupled transcription-translation system (Promega TnT T7/SP6 kit) and incubated with 0.5 ng radiolabelled oligonucleotide probe in binding buffer (20mM Tris pH 7.6, 75mM KCl, 0.25mg/ml, 1mM DTT, 10% glycerol) at room temperature for 10 minutes. For competition experiments, excess of unlabelled oligonucleotide probes was added and incubated for 10 minutes prior to addition of radiolabelled oligonucleotide probes. Binding reactions were analysed on 6% 0.5X TBE polyacrylamide gels electrophoresed at 150V; gels were dried prior to detection of signal by autoradiography. Probes used were, M10-c: GATGACTGCCCTTATTTGACC and M10mut: GATGACTGggaggATTTGACC.
+ Open protocol
+ Expand
2

Protein-DNA Binding Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Recombinant proteins were synthesized using a coupled transcription-translation system (Promega TnT T7/SP6 kit) and incubated with 0.5 ng radiolabelled oligonucleotide probe in binding buffer (20 mM Tris [pH 7.6], 75 mM KCl, 0.25 mg/ml, 1 mM DTT, and 10% glycerol) at room temperature for 10 min. For competition experiments, the excess of unlabelled oligonucleotide probes was added and incubated for 10 min prior to the addition of radiolabelled oligonucleotide probes. Binding reactions were analyzed on 6% 0.5× Tris-borate-EDTA (TBE) polyacrylamide gels electrophoresed at 150 V; gels were dried prior to detection of signal by autoradiography.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!