Rnase free water

Optima LC/MS grade methanol and water; and JT Baker potassium sorbate, sodium carbonate, Invitrogen Trizol reagent; and ACS grade chloroform, methanol, and ethanol were purchased from Fisher Scientific (Waltham, MA, USA). Citric acid, 1 N Folin–Ciocalteu reagent, 99% formic acid, (−)-epicatechin, naringenin, quercetin, cyanidin chloride, ellagic acid, gallic acid, 4-hydroxyphenylpropionic acid, 4-hydroxyphenylacetic acid, enterodiol, hippuric acid, 2,2-diphenyl-1-picrylhydrazyl (DPPH), 2,2′-azino-bis(3-ethylbenzo-thiazoline-6-sulfonic acid) (ABTS), 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox), potassium persulphate were purchased from Sigma-Aldrich (St. Louis, MO, USA). M-MLV RT, M-MLV 5× reaction buffer, oligo (dT)15 primer, dNTP mix, SybrGreen master mix, and RNAse-free water were purchased from Promega.

A MirVana™ miRNA isolation kit (Ambion) was used to extract the total RNA from VSMC according to the instructions of the manufacturer. The extracted RNA was stored in a −80°C freezer in RNase‐free water (Promega UK). A BioTek Power Wave XS (SSi Robotics) spectrophotometer was used to detect the purity, concentration and content of RNA in each sample. A commercial cDNA Synthesis Kit (Invitrogen) was used to synthesize the cDNA, and an EXPRESS SYBR Green qRT‐PCR Kit (Invitrogen) was used to amplify the cDNA in a 20 mL system containing 1.5 mmol/L primer, 10 mL SYBR Green mix, 1.0 mL template cDNA and water. A Mini Opticon Real‐time PCR System (Life Technologies) was used to perform real‐time PCR based on the manufacturer's recommendation. The 2^−ΔΔCT method was used to calculate the relative expression of EGFR (Forward primer: 5’‐AACACCCTGGTCTGGAAGTACG‐3’; Reverse primer: 5’‐ TCGTTGGACAGCCTTCAAGACC‐3’) and miR‐214 (Forward primer: 5’‐ TGCCTGTCTACACTTGC‐3’; Reverse primer: 5’‐GAACATGTCTGCGTATCTC‐3’). The expressions of endogenous U6 (Forward primer: 5’‐ CTCGCTTCGGCAGCACA‐3’; Reverse primer: 5’‐ AACGCTTCACGAATTTGCGT‐3’) and GAPDH mRNA (Forward primer: 5’‐ GTCTCCTCTGACTTCAACAGCG‐3’; Reverse primer: 5’‐ ACCACCCTGTTGCTGTAGCCAA‐3’) were, respectively, used as internal control for miR‐214 and EGFR mRNA. Three independent tests were performed.

Trizol and HPLC-grade acetonitrile were purchased from Thermo Fisher Scientific (Waltham, MA, United States). LB was supplied by National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). Pterostilbene (used as the IS, Figure 1B) was purchased from Great Forest Biomedical Ltd. (Hangzhou, China). NADPH-regenerating solution was obtained from iPhase Pharmaceutical Services (Beijing, China, containing 21.7 mM of NADP⁺, 55 mM of G-6-P, 6.67 U/mL of G-6-PDH and 55 mM of MgCl₂). Cimetidine, α-naphthoflavone, quinindium, 4-methylpyrazole, and ketoconazole were from J&K Chemical (Beijing, China). Oligo(dT) 15 primer, RNase-free water, RNasin Plus RNase Inhibitor, 5× M-MLV Reverse Transcriptase buffer, M-MLV Reverse Transcriptase and dNTPs were obtained from Promega Corporation (Madison, WI, United States). SYBR^® Premix Ex Taq™ (Tli RNaseH Plus) was from TAKARA BIO INC. (Dalian, China). Enhanced RIPA lysis buffer and protein loading buffer were purchased from Solarbio Life Sciences (Beijing, China). Primary antibodies of CYP1A2, CYP2C11, CYP2D1, CYP2E1, and CYP3A2 were supplied by Abcam PLC (Cambridge, United Kingdom). Primary antibody of GAPDH was from Beyotime Biotechnology (Shanghai, China) and HRP-conjugated secondary antibody was from ComWin Biotech Co., Ltd. (Beijing, China). All other chemicals and solvents were of analytical grade.

For co-immunoprecipitation (CoIP), 4 μg primary antibodies or control normal IgG were conjugated to 40 μL Dynabeads Protein G (Invitrogen) for 45 min at RT. HEK293 cells which were transfected with full-length or truncated RBM3 and IMP2 overexpressing pCMV plasmids (as described above) were harvested 48 h after transfection. HEK293 or P0 NSPC cell lysates were incubated with antibody-coupled Dynabeads Protein G overnight at 4 °C. For RNase-treated group, cell lysates were pretreated with 10 U/μl RNaseT1 (Fermentas) for 15 min at RT before subjected to beads. Proteins were eluted from beads in NuPAGE LDS Sampler Buffer (Invitrogen) containing 50 mM DTT at 70 °C for 10 min. Samples were analyzed by Western blot. RNA-immunoprecipitation (RIP) was performed in a native way similar to CoIP. After mock or OGD treatment, the starting material was adjusted to 5 × 10⁶ cells per sample. All the reagents contained 40 U/mL RNase inhibitor RNasin (Promega) and prepared in RNase-free water (Promega) to minimize the activity of RNase from the environment. Immunoprecipiated RNA was eluted in lysis buffer from above-mentioned total RNA isolation kit at 70 °C for 10 min, and further purified by the kit. Samples were analyzed by quantitative RT-PCR.

Total RNA was isolated from murine lung tissue or cells using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s instructions. Briefly, the RNA precipitate was washed twice by gentle vortexing with 70% ethanol, collected by centrifugation at 12000 rpm, dried under a vacuum for 5–10 min, dissolved in 200 μl RNase-free water (Promega, Madison, WI, USA), and incubated for 10–15 min at 55–60 °C. The RNA was quantified and assessed for purity by spectrophotometry at a wavelength of 260 nm. The integrity was assessed by 2% agarose gel electrophoresis and the RNA was visualized by ethidium bromide staining. The GABA_AR subtype and Muc5ac mRNA transcripts were measured by RT-PCR as previously described30 (link)52 (link). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as the endogenous control gene. The PCR primers for mice and humans were designed according to the published cDNA sequences and synthesized by MDBio Inc (Taipei, Taiwan). The primers sequences are listed in Table 1. Mouse or human GAPDH mRNA was used as the internal control in all experiments. The mRNA expression levels of Muc5ac and GABA_AR subunits were measured by band intensities using the Gel Analysis method in ImageJ 1.49 and were normalized to the level of GAPDH.

Total RNA was isolated using the RNeasy Mini Plus Kit (Qiagen) according to the manufacturer's instructions. Quantification of total RNA was performed using a NanoDrop spectrophotometer (Thermo Scientific). Reverse transcription (RT) was performed using 1 μg RNA as per the manufacturer's instructions (Life technologies). Polymerase chain reaction (PCR) was then performed using the primer sequences shown in Table 1. Amplification was performed in a 20 μL volume by mixing 10 μL of 2× Green GoTaq Mix (Promega), 1 μL of 10 μM primers, and 0.5–1 μL cDNA. Final volume was adjusted with RNAse-free water (Promega). The instrumental settings were as follows: initial denaturation step of 2 min at 95°C, followed by 26–34 cycles as follows: denaturation 94°C for 30 s, annealing temperature for 30 s and extension 72°C for 30 s, and one cycle of 72°C for 5 min. PCR products were then analyzed by agarose gel electrophoresis (2%) containing 10,000 × GelRed Nucleic Acid Stain (Biotium).