100 mm rntps

dsRNA was prepared from in vitro transcription reactions (Promega) using PCR-generated forward and reverse templates with flanking T7 promoters (TAATACGACTCACTATAGGG). Each template (16 μl) was mixed with 1.6 μl of 100 mM rNTPs (Promega); 0.6 μl of 1M dithiothreitol (DTT; Promega); 4 μl of T7 polymerase; and 24 μl of 5x Transcription optimized buffer (Promega). Reactions were incubated for 4h at 37°C. RNA was purified by ethanol precipitation, and re-suspended in a final volume of 30 μl milliQ H2O. Forward and reverse strands were combined and annealed by heating at 56°C followed by cooling to 37°C. Animals were starved for 1-2 weeks prior to first RNAi feeding and were fed twice a week. RNAi food mixture was prepared using 12 μl dsRNA for 30 μl planarian food (homogenized beef liver) (Rouhana et al., 2013 (link)). For RNAi of two or more genes, dsRNA for each gene was diluted in half (Scimone et al., 2016 (link)). For β-catenin-1 double-RNAi experiments, animals were fed once with β-catenin-1 or control dsRNA at the end of the feeding regimen. C. elegans unc-22 was used as the control condition (Benian et al., 1989 (link)).