The selected genes were subjected to RT-qPCR to validate the transcriptome data. First, RNA from different treatment groups of primary IECs was extracted by Trizol method and then extracted RNA was reverse transcribed into cDNA with the help of the Prime Script RT Reagent Kit (TaKaRa, Shiga Prefecture, Japan). Primers used for gene quantification were from Shanghai Sanggen Biotech Co., Ltd. (Shanghai, China) and the sequences are shown in Table S1 . Following that, cDNA amplification was completed with the help of a PCR reaction kit (TaKaRa, Shiga Prefecture, Japan). The reaction conditions were denaturation at 95 °C for 1 min, 39 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 30 s. The reference gene selected was mouse GAPDH and the results were normalized and calculated by 2−∆∆Ct method.
Pcr reaction kit
Manufactured by Takara Bio
Sourced in Japan
The PCR reaction kit is a set of reagents and components designed to perform the Polymerase Chain Reaction (PCR) technique, a widely used method for amplifying specific DNA sequences. The kit includes the necessary enzymes, buffers, primers, and other essential elements required to carry out the PCR process.
Automatically generated - may contain errors
3 protocols using pcr reaction kit
1
RT-qPCR Validation of Transcriptome Data
2
Adenoviral Gene Expression Analysis via PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PSCAE gene, UPII gene, and E1A gene express in the recombinant adenovirus were identified by PCR. Firstly, harvested viruses were digested by proteinase K (Takara Biotechnology Co., Dalian, China), and then extracted virus DNA. PCR were performed according to PCR Reaction Kit (Takara) instruction. Gene expression bands were observed by agarose gel electrophoresis. The primer sequences were listed in Table 1 [9 (link), 18 (link)].
The primers used for polymerase chain reaction (PCR)
| PCR primers | Primers sequence |
|---|---|
| PSCAE | Forward: 5′ GCTGACCGGTAGAGGCCAGCAGCACCCCTG 3′ |
| UPII | Forward: 5’ ACT TTG AGC CTA CCC TTC C 3′ |
| E1A | Forward: 5’ CAT GCC ACA GGT CCT CAT ATA GC 3′ |
PSCAE prostate stem cell antigen enhancer, UPII uroplakin II promoter, E1A the early adenoviral genes
3
IFNγ mRNA Expression Analysis in Trigeminal Ganglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of IFNγ mRNA in trigeminal ganglia was assayed by real-time polymerase chain reaction (RT-PCR). The forward primer was 5′-ACGAAGCTTATGAAATATACAAGTTATATCTTG-3′, and the reverse primer was 5′-ATCCTCGAGTTACTGGGATGCTCTTCGAC-3′. β-actin was used as the internal control; the forward primer was 5′-GGACTTC GAGCAGGAGATGG-3′, and the reverse primer was 5′-GCACCGTG TTGGCGTAGAGG-3′. The isolation of total RNA and cDNA syntheses was carried out using a commercial kit (TIANGEN Biotech Co., Ltd.). The procedure and conditions of the RT-PCR were followed according to the requirement or the instruction of the PCR reaction kit (Takara Biotechnology Co., Ltd., Dalian, People’s Republic of China), using the ABI7500 RT-PCR System (Thermo Fisher Scientific, Waltham, MA, USA). The amplified DNA was run on 1.5% agarose gels; images were then digitally captured with a charge-coupled device camera and analyzed with an imaging analysis system.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!