The largest database of trusted experimental protocols

Rneasy1 mini kit

Manufactured by Qiagen
Sourced in Germany

The RNeasy1 Mini Kit is a laboratory equipment designed for the extraction and purification of total RNA from a variety of sample types. The kit utilizes a silica-membrane-based technology to efficiently capture and isolate RNA molecules, enabling users to obtain high-quality RNA for downstream applications.

Automatically generated - may contain errors

4 protocols using rneasy1 mini kit

1

Quantifying Gene Expression in Klf4 Mutant MEFs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from cultured Klf4+/+ and Klf4−/− MEFs was isolated using RNeasy1 Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol. RNA was subjected to gDNA elimination columns (Qiagen, Valencia, CA) in order to remove any contaminating genomic DNA. cDNA was prepared from 500 ng of RNA and amplified with Omniscript RT Kit (Qiagen) and polyT primer (Integrated DNA Technologies, Coralville, IA). Synthesized cDNA was subjected for RT-qPCR analysis using SYBR® Green PCR Master Mix for 40 cycles (Life Technologies) following manufacturer’s protocol. The expression of Cdkn1a or Atg7 was normalized to the expression level of β-Actin. Relative fold change in gene expression level was calculated by comparing the normalized gene expression in Klf4−/− MEFs to that in Klf4+/+ MEFs, or comparing the Klf4-transfected MEFs to GFP-transfected MEFs. The gene expression levels of Klf4+/+ or GFP-transfected MEFs were set to 1. Data shown represents two independent experiments, each performed in triplicates. PCR reactions were performed using the following primers purchased from Integrated DNA Technologies (Coralville, IA). Atg7 F: 5’ TCT GGG AAG CCA TAA AGT CAG G 3’; Atg7 R: 5’ GCG AAG GTC AGG AGA A 3’; Cdkn1a F: 5’ ATC ACC AGG ATT GGA CAT GG 3’; Cdkn1a R: 5’ CGG TGT CAG AGT CTA GGG GA 3’; β-Actin F: 5’ ATG GAG GGG AAT ACA GCC C 3’; β-Actin R: 5’ TTC TTT GCA GCT CCT TCG TT 3’.
+ Open protocol
+ Expand
2

Total RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from the thawed frozen tissues using TRIzol® Plus RNA Purification Kit (Life Technologies Pty Ltd. Victoria, Australia). Homogenisation of the sample in TRIzol® reagent was performed using a tissue lyser (Qiagen Ltd., Crawley, UK). RNA was extracted using chloroform and precipitated using isopropanol. The quantity of total RNA extracted was assessed using the NanoDrop 8000 spectrophotometer (NanoDrop, Wilmington, DE). RNA quality was verified by ensuring that all RNA samples had an absorbance ratio (A260/280) between 1.8 and 2. RNA samples were treated with PureLink™DNase (Life Technologies Pty Ltd. Victoria, Australia) and purified using the RNeasy1 Mini Kit (Qiagen Ltd.). DNase-treated and purified total RNA was then reverse transcribed to cDNA with Mixed Oligo dT/Random Hexamer Primers using the Tetro cDNA Synthesis Kit (Bioline Pty Ltd. NSW, Australia) according to the manufacturer’s instructions and stored at −80°C for subsequent analyses.
+ Open protocol
+ Expand
3

RNA Extraction from Vitamin B6 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Extraction of RNA from vitamin B6 cultured cells was performed using an RNeasy1 mini kit (Qiagen, Hilden, Germany) as per the manufacturer’s instructions. Messenger RNA (mRNA) from treated cells was extracted from each cell pellet by disrupting cells with lysis buffer/mercaptoethanol mix. Cells were lysed, and the lysate was placed in the supplied Qia-shredder columns for homogenization, and then transferred to RNeasy mini-spin columns. DNase was used to eliminate any genomic DNA contamination with the RNase-free DNase set (Qiagen, Hilden, Germany). Samples were evaluated for RNA integrity number (RIN) using the Agilent 2100 Bioanalyser and Agilent RNA 6000 nano kit (Agilent Technologies, Santa Clara, CA, USA). All samples tested and used had an RIN higher than the cut-off point of 8.
+ Open protocol
+ Expand
4

Gene Expression Analysis of bEnd.3 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from confluent bEnd.3 cells grown in petri dishes, using RNeasy1 Mini Kit (Qiagen, Hilden, Germany). RNA quality was checked by Experion automated electrophoresis system (Bio-Rad Hercules, CA, USA) and cDNA synthesis was performed by Qiagen RT2 HT First Strand cDNA kit using 2.0mg of RNA. RT2 SYBR Green Mastermix was used to amplify and quantify genes expression on a cycler (Bio-Rad iQ5 model). Specific primers were designed for gene relative expression of CDKN1A (F: 50 TGACAGATTTCTATCACTCCAAG30 ; R: 50 TGACCCACAGCAGAAGAG30 ) and HDAC6 (F: 50 GCAGGAGGCAAGTTGATT30 ; R: 50 AAGAAGGGTGTGGAGTGA30 ). Data were analyzed by DDCT method after normalization to GUSB (F: 50 GGTGAAGGTGACAACAACT30 ; R: 50 CTGAATCCTCGTGCTTATTGA30 ) housekeeping gene expression.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!