Total cellular RNA was extracted from osteosarcoma cells or stable shRNA-expressing 143B cells (80-90% confluence) using TRIzol reagent (Invitrogen, 15596026). The RNA concentration was measured by the NanoDrop 2000 (Thermo Fisher Scientific, ND2000). The first-strand cDNA was synthesized from 2 μg of total RNA with random primers, and subsequent qPCR was performed using the GoTaq RT-qPCR kit (Promega, A6010). The experiment was carried out with the ViiA 7 Real-Time PCR System (Applied Biosystems, 4453534), and expression of mRNA was assessed based on the threshold cycle (Ct). The relative mRNA expression levels were calculated as 2-[(Ct of mRNA)-(Ct of GAPDH)] after normalization to GAPDH expression. qPCR primer sequences (F, forward; R, reverse; 5′→3′) were as follows: CYP26B1-F: GTTCTGCCTCGGAGCTGATT, CYP26B1-R: CAACCCAATCCCCCTGACAA; GP1BB -F: AGACCACGTGGGACAGAACT, GP1BB-R: CAGGGTCTGGACCGCATTG; IFI44-F: TGGGAGCTGGACCCTGTAAA, IFI44-R: CCTCCCTTAGATTCCCTATTTGCT; DDX10-F: ATGTACTTGGAGCGGCCAAA, DDX10-R: CCCAGCCCATCTGTTGAAGT; FOXA2-F: CTTCAAGTGCGAGAAGCAGC, FOXA2-R: CCGAGTTGAGCCTGTGAGG; HEY1-F: AGTTAGGAGAGAGCCGCTGA, HEY1-R: TGTTGCTGGGGCTGGTAAAT; GAPDH-F: AGGTCGGAGTCAACGGATTT; GAPDH-R: ATGAAGGGGTCATTGATGGCA.
Gotaq rt qpcr kit
Manufactured by Promega
Sourced in United States
The GoTaq RT-qPCR kit is a reagent system designed for quantitative reverse transcription-polymerase chain reaction (RT-qPCR) analysis. The kit provides the necessary components for the reverse transcription and amplification of RNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Viia 7 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Paraffin slicing machine, by Leica (1 mentions)
Goscript reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
2 protocols using gotaq rt qpcr kit
1
Quantitative Analysis of mRNA Expression
2
Immunohistochemical Analysis of Apollon Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rabbit polyclonal anti-Apollon antibodies were purchased from Abcam (cat. nos. ab84429 and ab19609; Cambridge, UK); the PV-6001 two-step immunohistochemistry kit (cat. no. PV-6001) was from OriGene Technologies, Inc. (Beijing, China); Invitrogen® TRIzol reagent (cat. no. 15596026) was from Thermo Fisher Scientific, Inc. (Waltham, MA, USA); the GoScript Reverse Transcription kit (cat. no. A5001) was from Promega Corporation (Madison, WI, USA); the GoTaq RT-qPCR kit (cat. no. A6001) was from Promega Corporation; paraffin-embedded machines, the paraffin slicing machine and the automatic upright microscope system (DM5000 B) were from Leica Microsystems (GmbH, Wetzlar, Germany); the 400W UV imaging system was from Kodak (Kodak, Tokyo, Japan); and the ABI PRISM 7500 PCR applications were purchased from Thermo Fisher Scientific, Inc.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!