The largest database of trusted experimental protocols

Tnf α

Manufactured by Keygen Biotech
Sourced in China

TNF-α is a laboratory equipment product that measures the levels of Tumor Necrosis Factor-alpha (TNF-α) in biological samples. TNF-α is a cytokine involved in systemic inflammation and the acute phase response. This product provides a tool for researchers to quantify TNF-α expression, which is relevant to the study of inflammatory processes and related disease states.

Automatically generated - may contain errors

9 protocols using tnf α

1

Isolation and Characterization of T Cell Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Isolation kits for CD8+ T cells and CD4+CD25+CD127low/− regulatory T cells and isolation LD and MS columns were purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). Rabbit polyclonal antibody to human A2aR and FoxP3 was obtained from Abcam (Cambridge, USA), while mouse polyclonal antibody to human CD8, CD39, CD73 and human lymphocyte separation solution was acquired from LianKe MultiSciences (Hangzhou, China). ARL67156 (CD39 antagonist) was obtained from Tocris Bioscience (Bristol, UK). α,β-Methylene-ADP (CD73 antagonist) was obtained from Santa Cruz (Delaware Ave, USA). MRS1754 (A2bR antagonist) and ZM241385 (A2aR antagonist) were purchased from Sigma (St. Louis, USA). All the antagonists were dissolved in DMSO and had a final concentration less than 3/1000. ATP was dissolved in DMSO and then further diluted in physiological saline. ATP and IFN-γ assay kits were acquired from Jiancheng (Nanjing, China). TNF-α and perforin assay kits were obtained from KeyGen Biotech (Nanjing, China). The adenosine assay kit was obtained from BioVision (Milpitas, USA). The cAMP assay kit was obtained from Cloud-Clone Corp. (Wuhan, China). The CFSE Cell Proliferation Assay and Tracking Kit was purchased from BestBioScience (Shanghai, China). PE Annexin V Apoptosis Detection Kit was obtained from BD Biosciences (Franklin Lakes, USA).
+ Open protocol
+ Expand
2

Tanshinone IIA Bioactive Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
The purity of tanshinone IIA (Sigma-Aldrich, St. Louis, MO, USA) was >97%, and its structure is presented in Fig. 1. Nuclear factor (NF)-κB (ml003404), tumor necrosis factor-α (TNF-α; ml001543), interleukin (IL)-1β (ml003549), IL-6 (ml002828), superoxide dismutase (SOD; ml022368), malondialdehyde (MDA; ml016824), cata-lase (CAT; ml026352) and glutathione peroxidase (GSH-PX; ml026404) enzyme-linked immunosorbent assay (ELISA) kits were obtained from Nanjing KeyGen Biotech. Co., Ltd. (Nanjing, China).
+ Open protocol
+ Expand
3

Protein Expression Analysis of BAFF and TNF-α

Check if the same lab product or an alternative is used in the 5 most similar protocols
The ventricle tissues were homogenized, and total proteins obtained using Tissue and Cell Total Protein Extraction Kits (Jiangsu KeyGEN BioTECH Corp., Ltd) were used to analyse BAFF and TNF‐α expression. Total protein (20 μg) was resolved via 15% SDS‐PAGE (Beyotime Biotech Co., Ltd., Shanghai, China) and then transferred to polyvinylidene fluoride membranes. Nonspecific protein binding on the membranes was blocked with 5% non‐fat milk for 2 h, followed by incubation with anti‐BAFF (Abcam plc.), anti‐TNF‐α (Proteintech Group, Inc.) and anti‐β‐actin (Cell Signalling Technology Inc.) antibodies overnight at 4°C. The anti‐β‐actin was selected as reference according previous study18 and due to the molecular weight of BAFF being close to that of anti‐GAPDH. After three washes with TBST buffer, the membranes were incubated with horseradish peroxidase‐conjugated secondary antibody at room temperature for 2 h. Proteins were detected using an enhanced chemiluminescence system and quantified using image J software.
+ Open protocol
+ Expand
4

Inflammatory Mediator Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Umb (purity ≥98%) was purchased from National Institutes for Food and Drug Control (Beijing, China). Freund’s complete adjuvant (FCA) was obtained from Sigma-Aldrich Co. (St Louis, MO, USA). TNF-α, IL-6, IL-1β, and prostaglandin E2 (PEG2) ELISA kits were purchased from Nanjing KeyGen BiotechCo., Ltd. (Nanjing, China). All antibodies were obtained from Cell Signaling Technology (Danvers, MA, USA).
+ Open protocol
+ Expand
5

Venenum Bufonis Characterization and Biological Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Venenum Bufonis was purchased from Anhui Province and authenticated by Professor De-an Guo (Shanghai Institute of Materia Medica, Chinese Academy of Sciences). The voucher specimens were deposited at the Shanghai Research Center for Modernization of Traditional Chinese Medicine, Shanghai Institute of Materia Medica. The major constituents of VB were qualitatively and quantitatively analyzed, as shown in the supplementary information (see supplementary Fig. S1 and supplementary Table S1 online). TNF-α, IL-6, and IL-1β enzyme-linked immunosorbent assay (ELISA) kits were supplied by Nanjing KeyGEN Biotech. Co., Ltd. (Nanjing, China). CK-MB, CK, AST, ALT, MDA, SOD, CAT, GSH, and GPx kits were purchased from Jiancheng Bioengineering Institute (Nanjing, China). Primary antibodies against TXNIP, TRX, p-NF-κBp65, NF-κBp65, p-IκBα, IκBα, p-IKKα, IKKα, p-IKKβ, and IKKβ, p-ERK, ERK, p-JNK, JNK, p-P38, and P38 antibodies were produced by Cell Signaling Technology (Danvers, Massachusetts, USA).
All other chemicals and reagents used in the studies were of analytical grade and were purchased from approved organizations.
+ Open protocol
+ Expand
6

EGb 761 Modulates Inflammatory Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
TNF-α, IL-6 and IL-1β enzyme-linked immunosorbent assay (ELISA) kits were provided by Nanjing KeyGEN Biotech. CO., Ltd. (Nanjing, China). CK, AST, LDH, MDA, SOD, CAT, GSH-Px and GR assay kits were produced by Jiancheng Bioengineering Institute (Nanjing, China). Antibodies against TLR4, NF-κB p65, B-cell lymphoma-2 (Bcl-2) and B-cell lymphoma-2 associated X (Bax) were purchased from Cell Signaling Technology (Beverly, MA, USA). TLR4 primers were obtained from TaKaRa Biotechnology Co. (Dalian, China). (The TLR4 forward primer: up, CTATCATCAGTGTATCGGTG; down, CAGTCCTCATTCTGG CTC, the GAPDH forward primer: AATGCATCCTGCCACCACCAACTGC, reverse primer: GGAGGCCATGTAGTAGGCCATGAGGTC). The Chinese medicine of EGb 761 which contained 6% of terpene trilactones, 24% of flavonol glycosides and less than 5 ppm of ginkgolic acids was purchased from Jiangsu Shenlong Pharmaceutical Co., 110722, Yancheng, China.
+ Open protocol
+ Expand
7

Protective Effects of CH against Inflammation

Check if the same lab product or an alternative is used in the 5 most similar protocols
CH (pure: 99%) was provided by National Institutes for Food and Drug Control (Beijing, China). Myeloperoxidase (MPO), Malondialdehyde (MDA), Superoxide dismutase (SOD), and Wright–Giemsa staining kits were purchased from the Institute of Jiancheng Bioengineering (Nanjing, China). The enzyme-linked immunosorbent assay (ELISA) kits for determination of Tumor necrosis factor-alpha (TNF-α), interleukin 6 (IL-6), and interleukin 1β (IL-1β) were produced by Nanjing KeyGEN Biotech. CO., LTD (Nanjing, China). Antibodies against nuclear factor erythroid 2-related factor 2 (Nrf2) (#12721), heme oxygenase (HO-1) (#70081), cyclooxygenase2 (Cox2) (#12282), nuclear factor kappa-B (NF-κB) p65 (#8242), IκBα (#4814), Phospho-IκBα (#2859), and β-Actin (#3700) were purchased from Cell Signaling Technology (Beverly, MA, United States). Lamin B1 (ab133741) and inducible Nitric Oxide Synthase (iNOS) (ab3523) antibodies were purchased from Abcam (Cambridge, MA, United States). Dimethyl sulfoxide (DMSO) and LPS were obtained from Sigma-Aldrich (St. Louis, MO, United States). Protease Inhibitor Cocktail was obtained from Roche Technology (Basel, Switzerland). N-acetyl-L-cysteine (NAC) and 2′,7′-Dichlorofluorescin diacetate (DCFH-DA) were obtained from Beyotime Biotech (Nantong, China).
+ Open protocol
+ Expand
8

ELISA-Based Cytokine Detection

Check if the same lab product or an alternative is used in the 5 most similar protocols
IL-1β and tumor necrosis factor-α (TNF-α) were detected with IL-1β (Proteintech Group, INC., China) and TNF-α (KeyGEN BioTECH, China) ELISA kits according to the manufacturer’s recommendations, and the absorbance was measured with an EnSpire ELISA (PerkinElmer, United States).
+ Open protocol
+ Expand
9

Fasudil Modulates Inflammatory Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fasudil was purchased from Tianjin Chase Sun Pharmaceutical. Co., Ltd (Tianjin, China). Enzyme-linked immunosorbent assay (ELISA) kits of IL-1β, IL-6 and TNF-α were obtained from Nanjing KeyGEN Biotech. CO., LTD. (Nanjing, China). Primary antibodies against RhoA, ROCK1, ROCK2, p-NF-κBp65, NF-κBp65, caspase-3, caspase-9, bax and Bcl-2 were produced by Cell Signaling Technology (Danvers, USA).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!