Azure cielo real time pcr system

Total RNA was isolated from whole brains (n = 5 per group) of male Sub and Dom mice utilizing an EZ-RNA Total RNA Isolation Kit according to the manufacturer’s guidelines (Biological Industriess, Israel). RNA was eluted in a volume of 100 μL and RNA concentration was determined by NanoDrop One Microvolume UV-Vis Spectrophotometer (Thermo Scientific, Waltham, MA, United States). cDNA synthesis was performed on 2000 ng (two reactions per sample) of total RNA employing a Verso cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, United States) according to the manufacturer guidelines. Primers were designed by Integrated DNA Technologies (Coralville, IA, United States) employing FAM/ZEN/IBFQ configuration:
The Gapdh gene was used as an endogenous control. RT-PCR was performed on an Azure Cielo Real-Time PCR system (Azure Biosystems, Dublin, CA, United States) using Prime-Time qPCR Primer Assays (Integrated DNA Technologies, Coralville, IA, United States) in a 20 μL reaction mix containing 3 μL of cDNA, 10 μL of 2× master mix buffer, 1 μL of Prime-Time qPCR Probe assay mix (containing primers and probe), and 6 μL of water. The amplification program was as follows: 95°C for 3 min, 44 cycles of 95°C for 10 s, and 60°C for 30 s.

For quantification of TPA strains during single in vitro cultivation, qPCR detection was designed for the polA gene (TP0105; product size 129 bp) using two primers (5’–GAGTGTGCAGTCCGCTATGC–3’ and 5’–AGGCAAAAGCGGCATTTCTA–3’) and one probe qPCR_polA_probe (5’–FAM-TCCGCTTGGAAACAGCAGGATTG-BHQ–3’) [17 (link)]. qPCR was performed using the Azure Cielo Real-Time PCR System (Azure Biosystems). Each PCR reaction (20 μl) contained Luna Universal Probe qPCR Master Mix (10 μl, New England Biolabs), primers (0.08 μl each, final conc. 400 nM), FAM-labeled probe (0.04 μl, final conc. 200 nM), template DNA (i.e., 5 μl of treponemal in vitro culture), and nuclease-free water (4.8 μl). PCR cycling conditions were 95°C (10 min), followed by 40 cycles at 95°C (10 s), and 60°C (30 s). A standard curve for TPA DNA was constructed using 10-fold serial dilutions (i.e., 10⁰–10⁶ copies/μl) of the pCR2.1-TOPO vector (Invitrogen) containing the cloned polA fragment.

Total RNA was extracted from the liver tissues of the mice by using TRIzol (T9424, Sigma-Aldrich, St. Louis, Missouri, USA) according to the manufacturer’s instructions [25 ]. The obtained RNA (5 μg) was reverse-transcribed using the PrimeScript RT Reagent Kit (RR037A; TaKaRa, Tokyo, Japan) according to the manufacturer’s instructions [26 ]. Quantitative polymerase chain reaction (PCR) was performed using the KAPA SYBR FAST qPCR Master Mix (KM4100; KAPA Biosystems) with specific primers ( Supplementary Table 1); for this, the Azure Cielo Real-Time PCR System (Azure Biosystems, Dublin, CA, USA) was used. Gene expression levels were normalized against the expression level of actin, and the relative changes in gene expression were quantified using the 2^−ΔΔCt method.