Protein a magnetic beads

Fragmented RNA was incubated with an anti-m⁶A polyclonal antibody (Synaptic Systems, 202003) in immunoprecipitation (IPP) buffer for 2 h at 4 °C^{25 (link)}. The reaction mixture was then immunoprecipitated with protein A magnetic beads (Thermo Fisher, MA, USA) at 4 °C for 2 h. Next, the bound RNA was eluted from the beads with N6-methyladenosine antibody in IPP buffer and extracted with TRIzol reagent (Thermo Fisher, MA, USA). The extracted RNA was then prepared with a NEBNext Ultra II Directional RNA Library Prep Kit (NEB, MA, USA). Both the input sample (without immunoprecipitation) and the m⁶A immunoprecipitational samples were subjected to 150 bp paired-end sequencing on an Illumina HiSeq sequencer.

Anti-p53, anti-p21 and anti-Cdc25c mouse monoclonal antibodies were from Santa Cruz Biotechnology (CA, USA). Anti-Human PARP mouse polyclonal antibody was from BD Pharmingen (CA, USA). Anti-Flag mouse monoclonal antibody was from Sigma-Aldrich (Shanghai, China). anti-β-actin mouse monoclonal antibody was from Proteintech (Wuhan, China). Protein A Magnetic Beads and Protein G Magnetic Beads were from Thermo Scientific (Shanghai, China). Dimethyl sulfoxide was from Aladdin for dissolving S9, and S9 was dissolved with DMSO to make into 100 mM storage solution for in vitro experiments. Q-VD-OPh was obtained from Selleckchem (HOU, USA). siLenFect Lipid Reagent was purchased from Bio-Rad (Shanghai, China). Effectene Transfection Reagent was purchased from QIAGEN (Shanghai, China).

HeLa cells (non-treated or following α-amanitin treatment for 4 h) were collected and centrifuged at 500 × g for 5 min at 4 °C. In total, 1 × 10⁶ cells were used per co-immunoprecipitation assay. Each pellet was resuspended in 200 μl of Lysis buffer (10 mM Hepes pH7.5, 2 mM MgCl₂, 25 mM KCl, 0.1 mM DTT, 0.01 mM PMSF, 0.1%(V/V) Triton X-100, 0.1%(V/V) NP40 and supplemented with protease inhibitors). Cells were left in Lysis buffer, on ice, for 1 h. All samples were ple-cleared using protein A magnetic beads (Thermo Fisher Scientific) for 30 min at 4 °C with end-to-end rotation. Immunoprecipitation replicates were incubated overnight with NDP52 antibody (1:100 dilution) at 4 °C with end-to-end rotation. The following day, 50 μl of protein A magnetic beads, pre-equilibrated in Lysis buffer, were added to each sample, including the no-antibody controls, and incubated at 4 °C with end-to-end rotation for 2 h. Following this, beads were collected using a magnetic rack and washed three times with PBS. After removing all PBS, 50 μl of loading buffer (NuPAGE LDS sample buffer supplemented with 50 mM DTT) were added and samples were incubated at 95 °C for 10 min. Samples were then loaded on SDS-PAGE gels for in-gel protein digestion for LC-MS/MS.

Firstly, the collected RNA was fragmented. Secondly, protein A magnetic beads (Thermo Fisher Scientific, Waltham, MA, USA) were incubated with anti-m⁶A antibody (abcam, Cambridge, UK) at room temperature for 1 h. Thirdly, the recovered RNA fragments were co-incubated with the mixture of magnetic beads and antibodies at 4 °C for 3 h. Fourthly, the above mixture was eluted with elution buffer, and the collected RNA was reverse-transcribed by HiScript reverse transcriptase. Lastly, the corresponding mixture of cDNA was configured according to AceQ SYBR^® qPCR Master Mix (Vazyme), and the expression levels of BCL2 and TLR4 were detected using a ViiA7 Real-Time PCR System instrument. The percentage input method was used for data analysis, where % input = 2^{−(Average CTRIP − AverageCTinput − log2(input dilution factor))}. Related primer sequences were as follows: TLR4 F, CCGGCTGGTTTTGGGAGAAT and R, ATGGTCAGGTTGCACAGTCC; BCL2 F, CAGTTGCTCTGCTGTTTGAGG and R, CATTACTCTAGTGCTCCCCGC.

For MeRIP-seq, total RNA was isolated using TRIzol reagent. The obtained mRNA was further purified using the Dynabeads mRNA DIRECT Kit (Thermo Fisher) and fragmented by sonication. MeRIP-seq and library preparation were performed as per the reported protocol³³ (link) with some modifications. In brief, sonicated mRNA was mixed with m⁶A antibody (Synaptic Systems, 202003) in IP buffer and incubated under head-to-tail mixing at 4°C for 2 h. The mixture was supplemented with protein A magnetic beads (Thermo Fisher) and incubated under head-to-tail mixing at 4°C for another 2 h. The beads were then washed with IP buffer three times before elution with m⁶A elution buffer two times. The eluates were combined and purified by an RNA Clean and Concentrator (Zymo, Orange, CA). The purified mRNA fragments were used to construct libraries with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Sequencing was carried out on the Illumina HiSeq 2000 system with pair-end 150-bp read length. Reads were aligned to human genome version 38 (GRCh38) with TopHat. The longest isoform was retained if a gene had more than one isoform. Differential m⁶A-modified peaks between IP and input samples were identified using exomePeak (p < 0.01).