Transscript uni all in one first strand cdna synthesis supermix for qpcr

Human normal lung epithelial BEAS-2B cells and lung cancer cell lines PC9, H1299, and A549 cells were cultured in DMEM plus 10% fetal bovine serum (FBS) at 37 °C and 5% CO₂. Total RNA was extracted from cells using TRIzol reagent (Takara, Kyoto, Japan). Primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), and the MNDA primers were 5′-ACTGACATCGGAAGCAAGAGGG-3′ (forward) and 5′-TGCAGATGTGCTGGCTCCTGAG-3′ (reverse), the SPI1 primers were 5′-GACACGGATCTATACCAACGCC-3′ (forward) and 5′-CCGTGAAGTTGTTCTCGGCGAA-3′ (reverse). Each sample was reverse-transcribed into cDNA using TransScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Transgen, Tianjing, China). Then, the cDNA was synthesized by reverse transcription and amplified using 2× SYBR Green qPCR Master Mix (Bimake, Houston, TX, USA) according to the manufacturer’s instructions. qPCR was performed at 95 °C for 3 min, and 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. GAPDH and β-actin were the internal references for the target genes. The relative expression levels of mRNA were calculated using the 2−ΔΔCT method.

Total RNAs from cells were extracted using TransZol reagent (TransGen Biotech Co., Ltd.) according to the manufacturer’s instructions. Reverse transcription was performed using TransScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen Biotech, AU341). The mRNA expression levels were detected using Unique Aptamer Green Master Mix (Novogene, Tianjin, China) on LightCycler 96 Detection System (Roche, Basel, Switzerland). Detection of GAPDH mRNA expression was used for normalization. Primers used in this study are listed in Supplementary Table S1.

Total RNA was extracted using TRIzol reagent (Takara Bio, Kusatsu, Japan) and evaluated using the NanoDrop 2000 system (Thermo Fisher Scientific, Carlsbad, CA, USA) to determine RNA purity and concentration. RNA samples were reverse transcribed using TransScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal; TransGen Biotech, Beijing, China). PerfectStart Green qPCR SuperMix (TransGen Biotech) was used for qPCR using an ABI 7500 Fast System. The primer sequences of LINC00174 is as follows: forward: GGCCCAACACTTCCCTCAAA, reverse: CAGGGAGAAACGACCTGGAG. We used β-actin as an internal reference and the 2^−ΔΔCt method for gene expression analysis.

Total RNA was extracted with Trelief RNAprep FastPure Tissue&Cell Kit (Tsingke). First‐strand cDNA was synthesized using the TransScript Uni All‐in‐One First‐Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech) with 1 µg of RNA as the template for each reaction. mRNA levels were quantified under optimized conditions with Hieff qPCR SYBR Green Master Mix (Yeasen) according to the manufacturer's instructions. Rps18 and RPS18 were used as the reference genes for mouse and human samples, respectively.

cDNA of apple and tobacco were transcribed from 2 µg of total RNA in 20 µL reaction mixtures using a TransScript Uni All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) (TransGen, Beijing, China). qRT-PCR analyses were carried out using a PerfectStart Uni RT&qPCR kit (Perfect Real Time, TransGen) with the qRT-PCR primers shown in Supplementary Table S2 on an Applied Biosystems One-Step Plus instrument (Applied Biosystems, Foster City, CA, USA). The cycling conditions were as follows: 94 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 60 °C for 15 s, and 72 °C for 10 s. Gene transcript levels were normalized to that of MdActin. Each analysis was repeated three times. The 2^−ΔΔCt method was used to calculate relative transcript levels of each gene [48 (link)]. Three replicates of samples from different plants under the same conditions were collected for qRT-PCR analyses.

Total RNA from the cell lines, four ESCC tissue, and their paired paracancerous samples were isolated from tissues using the Accurate Biology kit (China). For cDNA, reverse transcription was performed using the TransScript uni all-in-one first-strand cDNA synthesis supermix for qPCR (TransGen Biotech, China), followed by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) on cDNA using 2× Universal Blue SYBR Green qPCR Master Mix (Servicebio, China). The expression value of the target gene was normalized to that of the internal control gene GAPDH (CT GAPDH). All primers used in this research are listed in supplementary file 1.