Dulbecco s modified eagle s medium dmem

Manufactured by Corning

Sourced in United States

Dulbecco's modified Eagle's medium (DMEM) is a cell culture medium commonly used for the in vitro maintenance and growth of various cell lines. It provides a balanced salt solution and essential nutrients required for cell proliferation and survival.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

DMEM medium (233 citations) Dulbecco’s modified (17 citations)

241 protocols using dulbecco s modified eagle s medium dmem

Transfection and Knockdown of RhoG in MEFs

Check if the same lab product or an alternative is used in the 5 most similar protocols

HeLa cells were maintained in Dulbecco’s modified Eagle’s Medium (DMEM) (Cellgro) supplemented with 10% fetal bovine serum (FBS) (HyClone), 100 U/mL penicillin and 100 μg/mL streptomycin (Cellgro) and 2 mM L-glutamine (Invitrogen) at 37°C and 5% CO₂. All cDNA constructs were transfected into cells using FuGene6 (Roche) according to the manufacturer’s instructions. IA32 Mouse Embryonic Fibroblast (MEF) cells were maintained in Dulbecco’s modified Eagle’s Medium (DMEM) (Cellgro) supplemented with 10% fetal bovine serum (FBS) (HyClone) and 1× GlutaMAX (Thermo Fisher Scientific).
IA32MEFs were transfected with either RhoG siRNA (CAGGTTTACCTAAGAGGCCAA) or Allstars Negative Control siRNA (Qiagen, United States). 7.5 μL, 10 μM siRNA was added to 250 μL serum-free DMEM. 3 μL lipofectamine RNAimax was added to another 250 μL serum-free DMEM. After 5 min, the two solutions were mixed and incubated for 20 min, followed by dropwise addition to a 35 mm dish. Medium was changed after 24 h and cells were split as required for use in experiments 48–72 h post-transfection, when knock-down efficiency was maximal. Control siRNA cells were incubated with 5 μM CFDA green for 20 min in serum-free DMEM. CFDA-labeled control cells were mixed with unlabeled RhoG siRNA cells immediately prior to the experiment.

Allen R.J., Welch C., Pankow N., Hahn K.M, & Elston T.C. (2020). Stochastic Methods for Inferring States of Cell Migration. Frontiers in Physiology, 11, 822.

+ Open protocol

+ Expand

Cultivation of Ovarian Cancer Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

High grade serous carcinoma cell line Kuramochi and non-serous ovarian carcinoma cell line SKOV3 were obtained from American Type Culture Collection (Manassas, VA) and the cells were authenticated by short tandem repeat analysis as described (13 (link)). Kuramochi cells were maintained in Roswell Park Memorial Institute (RPMI)-1640 medium (Cellgro) and SKOV3 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Cellgro), both at 37°C in a 5% CO₂ incubator. In both cases, the media were supplemented with 10% FBS (Gemini Bio-Products), 50 U/ml penicillin, 50 µg/ml streptomycin (Cellgro). For LPA-stimulation studies, 18.1 LPA (1-oleoyl-2-hydroxy-sn-glycero-3-phosphate; cat. no. 85730), was obtained from Avanti Polar Lipids (Alabaster, AL). LPA was dissolved in 10 mM stock solutions in phosphate buffered saline containing 1% BSA and stored at −80°C until use.
Human cell lines and methods used in this study were approved by the Institutional Review Board for the protection of the Human Subjects of the University of Oklahoma (approval no. 9599).

Ha J.H., Jayaraman M., Yan M., Dhanasekaran P., Isidoro C., Song Y.S, & Dhanasekaran D.N. (2021). Identification of GNA12-driven gene signatures and key signaling networks in ovarian cancer. Oncology Letters, 22(4), 719.

+ Open protocol

+ Expand

Isolation and Culture of Thy-1 Subpopulations of Mouse Embryonic Fibroblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rat fetal lung fibroblasts, which are entirely Thy-1–negative (RFL6; American Type Culture Collection, Manassas, VA), were cultured in Ham’s F12 K nutrient mixture (F-12K) media containing 10% FBS and 1% penicillin/streptomycin. Mouse embryonic fibroblasts (MEFs) were isolated from C57BL/6 mice and sorted for Thy-1 expression using FITC-labeled Thy-1.2-specific antibodies as previously described.^{19 (link)} Sorted MEFs were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Cellgro, Manassas, VA) supplemented with 10% FBS, in a humidified incubator with 5% CO₂. Two different batches of sorted Thy-1 subpopulations of MEFs were used in this study and yielded similar results.

Liu X., Wong S.S., Taype C.A., Kim J., Shentu T.P., Espinoza C.R., Finley C., Bradley J.E., Head B.P., Patel H.H., Mah E.J, & Hagood J.S. (2017). Thy-1 interaction with Fas in lipid rafts regulates fibroblast apoptosis and lung injury resolution. Laboratory investigation; a journal of technical methods and pathology, 97(3), 256-267.

+ Open protocol

+ Expand

Cell Viability and Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Iodixanol, rosiglitazone and GW9662 were purchased from Sigma Aldrich (St. Louis, MO, USA). Ez-Cytox cell viability assay kit was purchased form Dail Lab Service Co. (Seoul, Korea). Dulbecco’s Modified Eagle’s Medium (DMEM) was purchased from Cellgro (Manassas, VA, USA). FBS was purchased from Invitrogen Co. (Grand Island, NY, USA). Pierce™ BCA Protein Assay Kit was purchased from Thermo Scientific (Waltham, MA, USA). ECL Advance Western Blotting Detection Reagent was purchased from GE Healthcare (Amersham, UK). RIPA buffer, antibodies for p38 MAP kinase, phospho-p38, p44/42 MAP kinase (Erk1/2), phospho-p44/42 (Erk1/2), JNK, phospho-JNK, cleaved caspase-8, cleaved caspase-3, PPAR-γ and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and horseradish peroxidase (HRP) conjugated anti-rabbit antibodies were purchased from Cell Signaling (Boston, MA, USA).

Lee D., Kim C.E., Park S.Y., Kim K.O., Hiep N.T., Lee D., Jang H.J., Lee J.W, & Kang K.S. (2018). Protective Effect of Artemisia argyi and Its Flavonoid Constituents against Contrast-Induced Cytotoxicity by Iodixanol in LLC-PK1 Cells. International Journal of Molecular Sciences, 19(5), 1387.

+ Open protocol

+ Expand

Chondrocyte Culture Methodology

Check if the same lab product or an alternative is used in the 5 most similar protocols

Dulbecco’s modified Eagle’s medium (DMEM) was from Cellgro (Manassas, VA). HEPES, 100× non-essential amino acids (NEAA), and 100× insulin-transferrin-selenium (ITS) were purchased from Gibco (Carlsbad, CA). Ascorbic acid and l-proline were from Fisher Bioreagents (Pittsburgh, PA). Human recombinant IL-1α and human recombinant IL-1Ra were from PeproTech (Rocky Hill, NJ). Radiolabeled ³⁵S-sulfate was from PerkinElmer (Waltham, MA). Proteinase K was purchased from Roche Diagnostics (Risch-Rotkreuz, Switzerland). Dermal punches were purchased from Moore Medical (Farmington, CT). Tissue culture well plates were from Cellgro (Manassas, VA). Additional reagents were from Sigma-Aldrich (St. Louis, MO) where not otherwise noted.

Mehta S., Akhtar S., Porter R.M., Önnerfjord P, & Bajpayee A.G. (2019). Interleukin-1 receptor antagonist (IL-1Ra) is more effective in suppressing cytokine-induced catabolism in cartilage-synovium co-culture than in cartilage monoculture. Arthritis Research & Therapy, 21, 238.

+ Open protocol

+ Expand

Evaluating SARS-CoV-2 Infectious Dose via Plaque Assay

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

L2 cells (ATCC CCL-149TM) were used for the MHV plaque assay. In addition, the mouse asterocytoma-derived cell line (DBT), was used to propagate MHV (generously provided by Julian Leibowitz, Texas A&M Health Science Center, College Station, TX). All cells used in this study were cultured at 37°C in 5% CO₂ in Dulbecco’s modified Eagle’s medium (DMEM; Cellgro) supplemented with 10% fetal bovine serum (FBS), penicillin (50 IU/mL), and streptomycin (50 μg/mL). MHV strain A59 (ATCC VR-764) was used for all the experiments in this study. The virus stocks used for this study were produced as previously described (59 (link)). The MHV viral titer used for all experiments was ~1.0 × 10⁴ PFU/mL. We chose 100 μL (1.0 × 10³ virus particles) to inoculate on each of our samples because 1.0 × 10² – 2.0 × 10³ virus particles is the predicted minimal amount of virus particles needed in order to infect someone (60 (link), 61 (link)). In addition, we chose 1.0 × 10³ virus particles because according to a recent publication modeling the SARS-CoV-2 viral titer when sneezing or coughing on a surface, the range of virus particles for a cough or sneeze was ~1.0 × 10³ – 1.0 × 10⁵, which is in this range (62 (link)).

Featherstone A.B., Brown A.C, & Chitlapilly Dass S. (2022). Murine Hepatitis Virus, a Biosafety Level 2 Model for SARS-CoV-2, Can Remain Viable on Meat and Meat Packaging Materials for at Least 48 Hours. Microbiology Spectrum, 10(5), e01862-22.

+ Open protocol

+ Expand

Adipogenesis in 3T3-L1 Preadipocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 3T3-L1 mouse preadipocyte cell line was purchased from the American Type Culture Collection (Manassas, VA, USA). Dulbecco’s modified Eagle’s medium (DMEM) was obtained from Cellgro (Manassas, VA, USA). Fetal bovine serum (FBS), penicillin/streptomycin (P/S) antibiotics, and bovine calf serum (BCS) were purchased from Gibco (Gaithersburg, MD, USA). The EZ-Cytox cell viability assay kit, a tetrazolium salt (WST-1)-based colorimetric assay kit, was purchased from Daeil Lab Service (Seoul, South Korea). Phosphate-buffered saline (PBS), 1-methyl-3-isobutylxanthine (IBMX), Oil Red O solution, isopropanol, dexamethasone, formaldehyde solution, insulin, genistein, and atorvastatin were purchased from Sigma-Aldrich (St. Louis, MO, USA). Primary antibodies, including phospho-ERK (P-ERK), ERK, phospho-JNK (P-JNK), JNK, phospho-P38 (P-P38), P38, PPAR-γ, C/EBP-α, C/EBP-β, GR, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and horseradish peroxidase (HRP)-labeled anti-rabbit secondary antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA). The ECL Plus Western blotting detection reagents were purchased from GE Healthcare (Piscataway, NJ, USA).

Lee D., Kim J.Y., Kim H.W., Yoo J.E, & Kang K.S. (2021). Combined Beneficial Effect of Genistein and Atorvastatin on Adipogenesis in 3T3-L1 Adipocytes. Biomolecules, 11(7), 1052.

+ Open protocol

+ Expand

Pancreatic Cancer Cell Culture Protocols

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

MiaPaCa-2 was purchased from ATCC. The murine cell line Panc02 was from Dr. Min Li (26 (link)). The murine cell line KPC was from Dr. Vonderheide (27 (link)). Cell line authentication was performed using short tandem repeat profiling. The cell lines tested negative for mycoplasma contamination. Cells were cultured in 5% CO₂ at 37°C in Dulbecco’s modified Eagle’s medium (DMEM, Cellgro, Herndon, VA) containing 10% fetal bovine serum (Gemini, Woodland, CA) and 50 U/ml penicillin/streptomycin (Cellgro, Herndon, VA).

Bakst R.L., Xiong H., Chen C.H., Deborde S., Lyubchik A., Zhou Y., He S., McNamara W., Lee S.Y., Olson O.C., Leiner I.M., Marcadis A.R., Keith J.W., Al-Ahmadie H.A., Katabi N., Gil Z., Vakiani E., Joyce J.A., Pamer E, & Wong R.J. (2017). Inflammatory monocytes promote perineural invasion via CCL2-mediated recruitment and cathepsin B expression. Cancer research, 77(22), 6400-6414.

+ Open protocol

+ Expand

Culturing Insulin-Secreting and Skeletal Muscle Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

INS-1 cells (Biohermes, Shanghai, China), a rodent insulin-secreting β-cell line, were cultured in Roswell Park Memorial Institute 1640 medium (Cellgro, Manassas, VA, USA) containing 0.05 mM 2-mercaptoethanol, 2 mM L-glutamine, 1 mM sodium pyruvate, 11 mM D-glucose, 1% penicillin/streptomycin (P/S), 10 mM HEPES, and 10% fetal bovine serum (FBS) at 5% CO₂ at 37 °C. C2C12 skeletal muscle cells (American Type Culture Collection, Manassas, VA, USA) were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Cellgro) containing 1% P/S and 10% FBS at 5% CO₂ at 37 °C. The samples used in the present study, schisandrol A, schisandrol B, and schisandrin C, were isolated and purified previously. The purity of these compounds was determined to be over 98% by UHPLC-UV chromatography (see Supplementary Materials).

Lee D., Kim Y.M., Kim H.W., Choi Y.K., Park B.J., Joo S.H, & Kang K.S. (2021). Schisandrin C Affects Glucose-Stimulated Insulin Secretion in Pancreatic β-Cells and Glucose Uptake in Skeletal Muscle Cells. Molecules, 26(21), 6509.

+ Open protocol

+ Expand

Cell Culture and EBV-Transformed Lymphocyte Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T or U2OS cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Corning Cellgro) with 10% fetal bovine serum (FBS) (Atlanta Biologicals) and 1% penicillin/streptomycin (P/S) (Gibco) in 5% CO₂ at 37 °C. Patient EBV transfected lymphocytes (17 (link), 18 (link)) were grown in suspension in RPMI 1640 (Corning) with 10% FBS and 1% P/S.

McKinzey D.R., Gomathinayagam S., Griffin W.C., Klinzing K.N., Jeffries E.P., Rajkovic A, & Trakselis M.A. (2021). Motifs of the C-terminal domain of MCM9 direct localization to sites of mitomycin-C damage for RAD51 recruitment. The Journal of Biological Chemistry, 296, 100355.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!