The very sensitive nested real-time PCR method targeting the Plasmodium cytochrome b gene as described by Canier et al. (2013) in Plasmodium blood stages was performed to detect Plasmodium species with some modifications [42 (link)] in the known primary vectors of the area, i.e., Anopheles minimus and Anopheles baimaii [4 (link),38 ]. For parasite sporozoite screening in mosquitoes, we used DNA extracted from the head and thorax dissected from a single Anopheles specimen for each reaction. As we obtained little DNA from the head and thorax part of a single mosquito, we used the more sensitive technique of detection by nested quantitative PCR (nqPCR) for cytochrome b gene, which has more copy numbers, and this method is more sensitive in detecting a low amount. For all the real-time assays, in a 10 µL reaction volume, Promega 2× SYBR green master mix was used with carboxy-X-rhodamine (CXR) passive dye where 2.5 µL DNA was used as a template, and for every sample, the reaction was carried out in duplicate.
Sybr green master mix
Manufactured by Promega
Sourced in United States, China, Sweden, Italy
SYBR Green Master Mix is a ready-to-use solution for real-time PCR amplification. It contains SYBR Green I dye, Taq DNA polymerase, and required PCR components.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (36 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (8 mentions)
High capacity cdna reverse transcription kit, by Promega (7 mentions)
Rneasy mini kit, by Qiagen (7 mentions)
Cdna synthesis kit, by Thermo Fisher Scientific (5 mentions)
M mlv reverse transcriptase, by Promega (5 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (4 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (4 mentions)
Lightcycler 480, by Roche (4 mentions)
Tri reagent, by Merck Group (4 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (3 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Steponeplus, by Thermo Fisher Scientific (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (3 mentions)
Goscript reverse transcription system, by Promega (3 mentions)
Primerquest, by Integrated DNA Technologies (3 mentions)
Nanodrop 1000, by Thermo Fisher Scientific (2 mentions)
Mx3005p qpcr system, by Agilent Technologies (2 mentions)
A5001, by Promega (2 mentions)
113 protocols using sybr green master mix
1
Sensitive Nested Real-Time PCR for Plasmodium Detection
2
qRT-PCR Analysis of ATF3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Ambion, CA, USA) was used to isolate total RNA. RNA reverse transcription and RT-qPCR were performed as previously depicted [14 (link)]. cDNA was reverse transcribed from 1 μg of total RNA using a reverse transcription kit (Takara, Japan). β-actin was used as an internal reference. Amplification was performed according to the instructions of 2 × SYBR Green Master Mix (Promega, USA). PCR was performed with an initial denaturation at 95°C for 30 s, followed by denaturation at 95°C for 30 s and annealing/extension at 60°C for 30 s for 40 cycles. Relative gene expression levels were calculated using the 2-ΔΔCt method of qRT-PCR. The primers from NCBI were listed as follows:
ATF3 forward: 5′-TGCTCAGAGAAGTCGGAAGAA-3′;
ATF3 reverse: 5′-TGGCACAAAGTTCATAGGGCA-3′;
GAPDH forward: 5′-AGGTCGGTGTGAACGGATTTG-3′;
GAPDH reverse: 5′-GGGGTCGTTGATGGCAACA-3′.
3
Quantifying Gene Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instruction, and cDNA was synthesized on 2 µg of the total RNA template with random primers using the GoScript Reverse Transcription Mix (Promega, Madison, WI, USA). Real‐time PCR (RT‐PCR) was performed with 2×SYBR Green Master Mix (Promega, Madison, WI, USA). Expression of each gene of interest was normalized to reference gene GAPDH, and relative quantification was calculated by using 2−ΔΔCt method. For RNA stability assay, indicated cells were seeded to achieve 50% confluence and subsequently treated with 10 µm actinomycin D (APExBio, Houston, TX, USA), followed by collection at indicated time points. Total RNAs were extracted and analyzed by qRT–PCR.
4
Quantitative Analysis of Acta2 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with PBS, mixed with RNA lysis buffer (Zymo) and frozen at −80°C. Zymo Quick-RNA MicroPrep isolation kit was used to extract total RNA. 100% ethanol was added to the lysates and samples were than processed on the MicroPrep columns. DNA contamination was removed by DNAse I digestion. RNA was washed and eluted in 10 μl of water. RNA concentration and purity were assessed with Nanodrop 1000 (Thermo Fisher Scientific). Reverse transcription of 125 ng total RNA was performed using the Transcriptor First Strand cDNA Synthesis kit (Roche) and random hexamers, according to the manufacturer's protocol. qPCRs were performed with 2x SYBR Green master mix (Promega) and oligonucleotides for the genes of interest using an Agilent Technologies Stratagene Mx3005P qPCR system. Acta2 oligonucleotides: forward (5′->3′): CGCTGTCAGGAACCCTGAGA, reverse (5′->3′): CGAAGCCGGCCTTACAGA; Gapdh (housekeeping gene) oligonucleotides: forward (5′->3′): CTGCACCACCAACTGCTTAGC, reverse (5′->3′): GGCATGGACTGTGGTCATGAG. Relative Acta2 expression was normalized to Gapdh levels.
5
Reverse Transcription and qPCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription of 125 ng of RNA was performed using the Transcriptor First Strand cDNA Synthesis kit (Roche) and random hexamers, according to the manufacturer’s protocol. Briefly, RNA mixed with random hexamers was denaturated at 65 °C for 10 min. Afterwards, 5x reaction buffer, 10 mM dNTPs, reverse transcriptase and RNase inhibitor were added to the reaction. The cDNA synthesis program was the following: 10 min at 25 °C, 60 min at 50 °C, followed by 5 min at 85 °C. Subsequent qPCRs were performed with 2x SYBR Green master mix (Promega) on an Agilent Technologies Stratagene Mx3005P qPCR system. The amplification program consisted in a first step at 95 °C for 10 min, then 40 cycles of 95 °C for 30 s, and 60 °C for 60 s. A last amplification cycle was added to record the melting curve. Each sample was amplified in duplicate together with no retrotranscriptase controls and no template controls. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as reference housekeeping gene. Relative expression levels were calculated with the 2-ΔΔCt method. Primers used for reverse transcription-quantitative polymerase chain reaction analyses in murine and human cells are listed in Suppl. Table 4 and 5 , respectively.
6
Quantitative Real-Time PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative (real-time) RT-PCR was performed and analyzed as described in a previous study (Wang et al., 2017 (link)). Gill cDNA were synthesized by the Transcriptor First Strand cDNA Synthesis Kit (Roche) using random hexamer and poly(dT) primers. Real-time PCR was performed with 2X SYBR green master mix (Promega) and a StepOne Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific). The primers used for NCX1b (Na+, Ca2+ exchanger 1b), ECaC (epithelial Ca2+ channel), PMCA (plasma membrane Ca2+ ATPase), and internal controls of ribosomal protein L7 (RPL7) for tilapia or 18S ribosomal RNA (18S rRNA) for goldfish are shown in Supplementary Table S1 . Experiments were repeated three times, and groups were compared by Student’s t-test.
7
Gene Expression Analysis of Adrenergic Receptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzon reagent (CW0580A, CoWin Biotech Co., Inc., Beijing, China). cDNA was synthesized using reverse transcription kits (A5001, Promega Biotech Co., Ltd., USA). Primers were synthesized by Invitrogen Trading of Shanghai. RT-PCR was performed with SYBR Green Master Mix (M7122, Promega, WI, USA), Bench Top 100 bp DNA Ladder (G8291, Promega, WI, USA) was used to determine the size of the DNA. Seven tissue samples were included in each group. Each sample was tested in triplicate.
The following RT-PCR primers were used in these assays: β 1 -AR (forward:5'-CCTTTCGC TACCAGAGTTTGC-3'; reverse: 5'-CACTTGGGGTCGTTGTAGCAG-3'), β 2 -AR (forward: 5'-TCACTCAGGAACGGGACGAAG-3'; reverse: 5'-CAGCACACGCCAAGGAGATTATG-3'), β 3 -AR (forward: 5'-CACGCCGAGACTACAGACC-3'; reverse: 5' -CAACCAGTTTCGCCCAA G-3'), β-actin (forward: 5'-TGCTGTCCCTGTATGCCTCTG-3'; reverse: 5'-TTGATGTCACG CACGATTTCC-3').
The following RT-PCR primers were used in these assays: β 1 -AR (forward:5'-CCTTTCGC TACCAGAGTTTGC-3'; reverse: 5'-CACTTGGGGTCGTTGTAGCAG-3'), β 2 -AR (forward: 5'-TCACTCAGGAACGGGACGAAG-3'; reverse: 5'-CAGCACACGCCAAGGAGATTATG-3'), β 3 -AR (forward: 5'-CACGCCGAGACTACAGACC-3'; reverse: 5' -CAACCAGTTTCGCCCAA G-3'), β-actin (forward: 5'-TGCTGTCCCTGTATGCCTCTG-3'; reverse: 5'-TTGATGTCACG CACGATTTCC-3').
8
Circular RNA Quantification in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from CRC tissues and cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. RNA integrity was assessed using a SmartSpec Plus spectrophotometer (Bio-Rad Laboratories, Inc.), and RNA concentrations were determined using a NanoDrop ND2000 (Thermo Fisher Scientific, Inc.). Total RNA (1 µg) was reverse transcribed into cDNA using the GoScript RT System kit, with random primers (Promega Corporation; cat. no. A5001). The following thermocycling conditions were used: 25°C for 5 min, 42°C for 60 min and 70°C for 15 min. qPCR was subsequently performed using the SYBR-Green master mix (Promega Corporation; cat. no. A6001) and Mx3005P real-time PCR System (Stratagene; Agilent), according to the manufacturer's protocols. The following primer sequences were used for qPCR:hsa_circ_0001696 forward, 5′-GGAAGCAGTCTGCCCGAATA-3′ and reverse, 5′-CCAAGCACAGAGTCACCAGT-3′; and GAPDH forward, 5′-TCGACAGTCAGCCGCATCTTCTTT-3′ and reverse, 5′-ACCAAATCCGTTGACTCCGACCTT-3′. Relative expression levels were calculated using the 2−ΔΔCt method (26 (link)–28 (link)) and normalized to the internal reference gene GAPDH. All experiments were performed in triplicate.
9
Quantification of Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by using TRIzol reagent (Sigma-Aldrich), and cDNA was synthesized from total RNA using a Reverse Transcript Kit (Promega, USA). Relative quantitation of mRNA expression was achieved using real-time PCR (CFX Real-Time PCR system; Bio-Rad USA). The SYBR Green Master Mix (Promega) was used according to the manufacturer's instructions and the level of gene expression was measured by calculating 2−ΔΔCt. The sequences of primer for qPCR were as follows: ESR1-forward, TCCAAACCCATCGTCAGTGT. ESR1-reverse, TGAATGCAAAGGGGTCTGTGT. CCND1-forward, AAT GACCCCGCACGATTTCA. CCND1-reverse, TGAGGCG GTAGTAGGACAGG. MYC-forward, CTTGTTGCGGAA ACGACGAG. MYC-reverse, ACTCAGCCAAGGTTGT GAGG. PGR-forward, AGGTCTACCCGCCCTATCTC. PGR-reverse, AGTAGTTGTGCTGCCCTTCC. GAPDH-forward, CCCACTCCTCCACCTTTGAC. GAPDH-reverse, TGTTGCTGTAGCCAAATTCGTT.
10
RNA Extraction and qRT-PCR Analysis in N. benthamiana
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from N. benthamiana leaves by a NucleoSpin RNA plant mini-kit (Clontech). cDNA synthesis was performed on 1 µg of total plant RNA using an oligo(dT) primer and M-MLV reverse transcriptase (Invitrogen). Quantitative reverse transcription–PCR (qRT-PCR) was performed using SYBR Green master mix (Promega), gene-specific primers (Supplementary Table S3 ), and 2 µl of 10-fold diluted cDNA using a Bio-Rad 7300 thermocycler. Gene expression levels were normalized to Actin expression (Gabriëls et al., 2007 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!