The cells were first processed using enzymatic chromatin IP kit (Cell signaling technology), according to the manufacturer’s instructions. Nrf2 antibody (Cell signaling Technology) was used for ChIP analysis. The ChIP procedure was performed by PCR using the following human GSS promoter-specific primers: forward 5′-CTGGGAATAACCAGACACCTA-3′ and reverse 5′-CAGGTTCAAGCAATTCTCCTG-3′. The PCR cycle conditions were as follows: initial denaturation at 95 °C for 5 min; 40 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s; and a final extension at 72 °C for 7 min. The amplified products were resolved using electrophoresis and analyzed using image analysis software.
Enzymatic chromatin ip kit
Manufactured by Cell Signaling Technology
Sourced in United States
The Enzymatic Chromatin IP Kit is a laboratory equipment product designed for the isolation and purification of chromatin-associated proteins. The kit utilizes enzymatic digestion to release chromatin fragments from cells, which can then be immunoprecipitated to study protein-DNA interactions.
Automatically generated - may contain errors
Lab products found in correlation
Nrf2 antibody, by Cell Signaling Technology (1 mentions)
Quantifast sybr green pcr kit, by Qiagen (1 mentions)
Normal rabbit igg, by Cell Signaling Technology (1 mentions)
Anti stat3 antibody, by Santa Cruz Biotechnology (1 mentions)
Zeb1 antibody, by Santa Cruz Biotechnology (1 mentions)
Mrtf a, by Merck Group (1 mentions)
Dd1205 01, by Vazyme (1 mentions)
Anti hif 1α, by Proteintech (1 mentions)
Simplechip enzymatic chromatin ip kit, by Cell Signaling Technology (1 mentions)
Control rabbit igg, by Cell Signaling Technology (1 mentions)
Anti samhd1 antibody, by Fortis Life Sciences (1 mentions)
Anti tbx21 4b10, by Thermo Fisher Scientific (1 mentions)
Anti stat3, by Cell Signaling Technology (1 mentions)
15 protocols using enzymatic chromatin ip kit
1
Nrf2-Mediated Chromatin Immunoprecipitation
2
ChIP-PCR for Histone Modification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP-PCR was performed according to the manufacturer’s protocol provided in the Enzymatic Chromatin IP Kit (9003, Cell Signaling Technology, Danvers, MA, USA) as previously described in detail (Xing et al., 2019 (link)). Immunoprecipitation was performed using anti-Ace-H3K9 antibodies. Immunoprecipitated DNA was analyzed by PCR using the following primers: homo LPL, forward: 5′-GG GCCCCCGGGTAGAGTGG-3′, reverse: 5′-CACGCCAAGGCT GCTTATGTGACT-3′; homo PPARγ, forward: 5′-CTACTG TACAGTTCACGC-3′, reverse: 5′-GGGAGAGGTGGGAATA AA-3′; homo miR-29a, forward: 5′-ACGACAGATTGAAGGC CTGGG-3′, reverse: 5′-GGTGCTCTTCCCCAATCA-3′. Serial dilutions of input DNA were used as Input Samples for each primer pair. The equation shown below was used to calculate the IP efficiency. Percent Input = 2%*2(C[T]2% Input Sample− C[T] IP Sample), C[T] = CT = Threshold cycle of PCR reaction. The results for ChIP-PCR were expressed as folds of control.
3
ChIP-qPCR Analysis of MRTF-A/MMP9 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chromatin-immunoprecipitation analysis was performed using the Enzymatic Chromatin IP kit (Cell Signaling). In brief, 1.2 × 107 cells were cross-linked to DNA and the nuclear chromatin was digested. Two percent of this chromatin solution was used as input. The remaining solution was divided into three parts and incubated with an anti-Histone-H3 antibody, an anti-IgG antibody, an anti-MRTF-A antibody, respectively, with rotation at 4°C overnight. The next day, Protein G Magnetic Beads were added to each IP reaction. Then, chromatin was eluted, followed by reversal of cross-linking. The MRTF-A/MMP9 promoter complex signal was measured by PCR. The primer sequences were 5′-CAGGGAGTCTTCCATCACTTT CCCT (sense) and 5′-CCAGCATGAGAAAGGGCTTACACCA-3′ (antisense) for the MMP9 promoter; and 5′-TACTAGCGGT TTTACGGGCG-3′ (sense) and 5′-TCGAACAGGAGGAGCA GAGAGCGA-3′ (antisense) for GAPDH.
4
Genome-Wide Mapping of FOXO3a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the ChIP-Seq experiment, we utilized the Rabbit anti-FOXO3a antibody (#ab12162) obtained from Abcam, along with the Enzymatic Chromatin IP kit from Cell Signaling Technology. To begin, 4T1ApoA1 cells were cultured to reach 80% confluency and then cross-linked using 1% formaldehyde at room temperature for 10 min. To prepare the ChIP DNA, chromatin was digested with micrococcal nuclease and subsequently sonicated to generate fragments ranging in size from 100 to 500 base pairs. Following this, RNAse A and proteinase K were employed for further digestion, and the ChIP DNA was incubated overnight with 4 µg of the anti-FOXO3a antibody. The ChIP DNA was then purified using a column system based on magnetic separation, and the resulting eluted DNA was used as the input for the subsequent Chip-seq analysis. The DNA sequencing and analysis procedures were carried out by Novogene (Beijing, China).
5
Stat3 Chromatin Immunoprecipitation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP was performed using the Enzymatic Chromatin IP kit (no. 9003, Cell Signaling Technology, Danvers, MA, USA). Briefly, cells were crosslinked with 1% formaldehyde for 10 min. Chromatin was digested with MNase to generate fragments from 150 bp to 900 bp. For each sample, chromatin from one confluent six-well plate was immunoprecipitated with 10 µg of anti-Stat3 antibody (no. sc-13035, Santa Cruz Biotechnology, Dallas, TX, USA) or with normal rabbit IgG (No.2729, Cell Signaling Technology, Danvers, MA, USA). The protein in the samples was enzymatically digested to further purify the DNA. The number of DNA fragments containing target sequences in input chromatin and in chromatin immunoprecipitated (IP) with anti-STAT3 and IgG were quantified with a QuantiFast SYBR Green PCR Kit (no. 204054, Qiagen). Four target sequences were quantified, two containing the STAT3 binding sites in the NANOG promoter and two containing Stat3 binding sites in the NANOGP8 promoter (see ‘Primer design for Stat3 ChIP’ section for the target sequences). Quantification was performed by comparative CT method. The relative to input DNA copy number of each target sequence for each IP sample was calculated as 2 – (Ct( IP DNA) – Ct (Input DNA)). The number of copies of each target sequence in Stat3 ChIP was normalized by the copy number of IgG ChIP.
6
Chromatin Immunoprecipitation Protocol for ZEB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP was performed following the instructions of an Enzymatic Chromatin IP kit (cat no. 9003; Cell Signaling Technology, Inc., Danvers, MA, USA). Briefly, ~4×107 cells were prepared for each experiment. Formaldehyde (1% concentration) was added to crosslink proteins to DNA for 10 min. Following cell lysis and nuclei collection, the chromatin was fragmented by partial digestion with micrococcal nuclease to obtain chromatin fragments of 1–5 nucleosomes in size (150–900 bp). The crosslinked chromatin preparation was then immunoprecipitated with 5 µg polyclonal ZEB1 antibody (cat no. sc-25388 X; Santa Cruz Biotechnology, Inc., Dallas, TX, USA) or negative control normal rabbit IgG (cat no. 2729; Cell Signaling Technology, Inc.) at 4°C overnight. Elution of chromatin from the crosslinked complex using Protein G magnetic beads was performed with KingFisher Flex Magnetic Particle Processors. After reversing the crosslinks, DNA was purified using the reagents and spin columns provided in the Enzymatic Chromatin IP kit. In addition, a positive control histone H3 rabbit monoclonal antibody (cat no. 4620; Cell Signaling Technology, Inc.) and a primer for its known binding gene, ribosomal protein L30, were also included in the experiment to analyze IP efficiency. Three biological replicates were performed and successful enrichment was validated in each experiment.
7
Chromatin Immunoprecipitation (ChIP) Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We performed the chromatin immunoprecipitation (ChIP) assay by the Enzymatic Chromatin IP Kit (Cell Signaling, #9003S) according to the manufacturer's instructions. Antibody H3k27me3 (ABclonal, A2363,1:100) was used here. We performed qPCR to analyse the eluted DNA fragments. The primers we used are listed in Supporting Information Table S1
8
ChIP Analysis of MRTF-A Transcriptional Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was performed in HAECs co-transfected with MRTF-A, P300, and shSENP1 plasmids, using a commercially available Enzymatic Chromatin IP kit with magnetic beads (Cell Signalling Technology, Danvers, MA, USA). The proteins were cross-linked to DNA by formaldehyde at 2% concentration for 30 min at room temperature. The protein-DNA complexes were immunoprecipitated using primary antibodies against MRTF-A (1:200; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The signals of the CCN1/MRTF-A/P300/shSENP1 promoter complexes were measured by PCR. The primers used for the amplification of CCN1 were listed in Supplementary Information (Table S2) .
9
ChIP Assay for SLC26A3 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ChIP experiment was performed using the Enzymatic Chromatin IP Kit (9002 S, Cell Signaling Technology) according to the manufacturer’s protocol. Briefly, CRC cells transfected with the pCDNA3.1-p65 plasmid were treated with 1% formaldehyde to crosslink DNA and proteins; subsequently, the chromatin was sonicated and immunoprecipitated with 5 μg of anti-p65 antibody (8242 S, Cell Signaling Technology) at 4 °C overnight, while rabbit IgG served as negative control. After DNA extraction, PCR was performed to test the bound target DNA fragments. The amplified region consisted of −925 to −725 bp of the SLC26A3 promoter. Finally, the PCR products were visualized on a 1.8% agarose gel and stained with a nucleic acid-specific stain.
10
Investigating CTNND1 Regulation of CXCR4 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MDA-MB-231 cells transduced with sh-CTNND1 or sh-control were collected for ChIP assay. Cells were crosslinked in 1% formaldehyde solution for 10 min at room temperature and then added into 1 mL 1 × glycine buffer for 5 min. ChIP assay was performed by using Enzymatic Chromatin IP Kit (Cell Signaling Technology, 9003, Danvers, MA, USA), according to the manufacturer’s instructions. By using the Micrococcal Nuclease in the kit, the nucleoprotein complexes were digested to yield DNA fragments ranging from 200 to 500 bp. Two micrograms of normal IgG were used as the negative control, and anti-HIF-1α (Proteintech, 209601AP, Wuhan, China) antibodies were used for each immunoprecipitation. The immunoprecipitate was eluted and reverse-crosslinked, after which the DNA fragments were purified. Immunoprecipitated and input DNAs were subjected to qRT–PCR analysis. The primers used for amplifying the promoter of CXCR4 were forward: GAGTGCAGTCTGGGCAATCC and reverse: CGGGCGTCTTCCACGATTTTG; β-actin:forward:AGGAATGGGTGGGAAGTCAG and reverse: GGGCCAAGGACTCTTACTGT. Luciferase reporter assays were performed according to the manufacturer’s instructions (DD120501, Vazyme Biotech, Nanjing, China). Firefly and Renilla luciferase activities were detected by the Dual-Luciferase Reporter Assay System.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!