The largest database of trusted experimental protocols

26 protocols using quinine hydrochloride

1

Regulation of Bitter Taste Receptor T2R4

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were obtained from ATCC and maintained in 10% fetal bovine serum at 37°C in a 95% air and 5% CO2 chamber. hASMCs were a kind gift from Dr Andrew Halayko, Dept. of Physiology, University of Manitoba [20 (link)]. Quinine hydrochloride, yohimbine, denatonium benzoate, dapsone, parthenolide and dextromethorphan hydrobromide (DXM) were purchased from Sigma Aldrich (ON, Canada). Brefeldin A (BFA) was purchased from Cell Signaling Technology (ON, Canada), Mouse monoclonal M2 anti-FLAG antibody was from Sigma Aldrich and rabbit polyclonal anti-T2R4 antibody was from ThermoFisher Scientific (Toronto, ON, Canada). Goat anti-mouse Alexa Fluor-488 and goat anti-rabbit Alexa Fluor-488 were purchased from Molecular Devices (CA, USA). APC conjugated anti-FLAG monoclonal antibody was from BioLegend (CA, USA). The synthetic oligonucleotide primer sequences for human TAS2R4 (F -TCCTGCTGAAGCGGAATATC; R–GAAAAGGTGATGCCTGGCTA) were purchased from Invitrogen.
+ Open protocol
+ Expand
2

Taste Sensitivity Evaluation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tastants were sucrose (sweet; M = 342.30 g mol−1; Sigma-Aldrich, CAS Number: 57-50-1), citric acid (sour; M = 192.12 g mol−1; Sigma-Aldrich, CAS Number: 77-92-9); sodium chloride (salty; M = 58.44 g mol−1; Sigma-Aldrich, CAS Number: 7647-14-5), and quinine hydrochloride (bitter; M = 396.91 g mol−1; Sigma-Aldrich, CAS Number: 6119-47-7) diluted in deionized (DI) water. Based on pilot testing, we prepared sets of different concentrations for each taste quality individually. Concentration steps were equidistantly spaced on a decadic logarithmic grid as follows: sour, 0.015 mm to 46.846 mm (14 log10 steps; step width: 0.269); salty, 0.342 mm to 342.231 mm (12 log10 steps; step width: 0.273); sweet, 0.073 mm to 584.283 mm (14 log10 steps; step width: 0.300); bitter, 0.383 × 10-3 mm to 3.131 mm (18 log10 steps; step width: 0.230); see Table 1 for a complete list. DI water was used as a blank stimulus.
All tastants and the water were transferred to small glass bottles equipped with a spray head, and stored refrigerated at 5°C for a maximum duration of 7 days. Taste stimuli were aliquots of ~0.2 mL each, delivered to the anterior third (i.e., the tip) of the tongue.
+ Open protocol
+ Expand
3

Investigating Taste Receptor Signaling in Smooth Muscle Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dextromethorphan hydrobromide, chloroquine, denatonium benzoate, quinine hydrochloride, phenylthiocarbamide (PTC), 6-n-propylthiouracil (PROP), sodium thiocyanate, salicin, nicotine, yohimbine, colchicine, thiamine, caffeine, chloramphenicol and picrotoxinin were purchased from Sigma. Fluo-4 NW calcium assay kit was purchased from Invitrogen. hPASMCs and hASMCs were either purchased from ATCC or were a kind gift from Dr. Andrew Halayko, Dept. of Physiology, University of Manitoba. Cell culture media and hPASMC growth kit were purchased from Cedarlane, Canada. Nucleofection kit for smooth muscle cell transfection was purchased from Lonza. Polyclonal antibodies specific for T2R1, T2R38 and normal IgG specific rabbit antisera were obtained from Abcam (Cambridge, MA, USA) and Santa Cruz Biotechnology (Dallas, TX, USA) respectively [6] (link), [7] (link). Phospho-MLC-Ser19 monoclonal antibody and MLC polyclonal antibody were purchased from Cell Signaling technology (Danvers, MA, USA). DyNazyme hot start was purchased from Thermo Fisher Scientific (Toronto, ON, Canada). The shRNA specific for T2R1 was purchased from Qiagen (Toronto, ON, Canada).
+ Open protocol
+ Expand
4

Taste and Lipid Metabolism Assessment

Check if the same lab product or an alternative is used in the 5 most similar protocols
As taste stimuli, we used a “sweet solution” consisting of a mixture of 0.125% saccharin and 3% glucose (both Sigma-Aldrich, St Louis, MO) or a “bitter solution” consisting of 0.15% (0.0038 M) quinine hydrochloride (Sigma-Aldrich). The saccharin-glucose mixture is avidly ingested by rats [12] (link); the 0.15% quinine is strongly disliked–tasting it elicits negative hedonic responses (i.e., gapes and chin rubs) and it is almost completely avoided in two-bottle preference tests [7] (link). As an intragastric fat load, 20% intralipid was purchased from Sigma-Aldrich (Cat. No. I-141). Radioactive 14C-triolein was purchased from American Radiolabeled Chemicals Inc (St Louis, MO) and stored at −20°C until use.
The following enzymatic colorimetric kits or ELISA kits were used for the assay of blood components; triglycerides, ketones, glycerol and glucose from Cayman Chemical Co. (Ann Arbor, MI); non-esterified fatty acid from Wako Diagnostics (Richmond, VA); insulin from Alpco Diagnostics (Windham, NH); total GIP, total GLP-1 and leptin from Millipore (Billerica, MA); peptide YY and cholecystokinin from Phoenix Pharmaceuticals (Belmont, CA).
+ Open protocol
+ Expand
5

Synthesis and Antimalarial Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The chalcones were synthesized at the Institute of Organic Chemistry with Centre of Phytochemistry, Bulgarian Academy of Sciences, Sofia, Bulgaria. Chloroquine phosphate, quinine hydrochloride, glutamine, sodium bicarbonate, and β-haematin were purchased from Sigma Aldrich while artemisinin was from IPCA. The study was approved by Institute Ethics Committee Project No. NK/1265/Ph.D/23991 at Post Graduate Institute of Medical Education and Research, Chandigarh, for maintenance of P. falciparum strains in human erythrocytes and AB+ve human serum.
+ Open protocol
+ Expand
6

Flexibility of Food Intake under Aversion

Check if the same lab product or an alternative is used in the 5 most similar protocols
Chocolate adulteration provides information concerning flexibility of food intake under aversive conditions. Mice were given a free choice between SC and a pellet of the CM adulterated with quinine hydrochloride (Sigma-Aldrich) 1-g/kg food to give it a bitter taste. According to Heyne et al. (2009) (link), flexible mice will avoid or decrease the intake of CM.
+ Open protocol
+ Expand
7

Bitterness Perception Chemical Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sucrose, fructose and glucose were purchased from Sigma-Aldrich Co. (St. Louis, MO), with purity >99%. Acetic acid (>99% purity), sulfuric acid (>98% purity) and hydrochloric acid (36.5 to 38%) were purchased from Merck Inc. (Emanuel Merck, Darmstadt, Germany). Citric acid (>99% purity) and tartaric acid (>99% purity) were purchased from Mallinckrodt Pharmaceuticals (St. Louis MO) and Spectrum Chemical MFG Corp. (New Brunswick, NJ). Quinine hydrochloride (#Q1125) and denatonium benzoate (#D5765) were purchased form Sigma-Aldrich and lobeline hydrochloride (LTD #L0096) from Tokyo Chemical Industry Co. (Tokyo, Japan). All bitter chemicals were of > 98 % purity.
+ Open protocol
+ Expand
8

Sensory Evaluation of Sausage Consumers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Fifteen subjects were recruited among regular eaters of sausages (defined as consuming the product at least once a week). Ten panelists were selected (four males and six females, between 29 and 61 yr. of age) in accordance with ISO standards [26 ]. For this purpose, the four basic tastes were used [27 (link)]. For this purpose, sucrose (Carlo Erba, Milan, Italy), sodium chloride (Carlo Erba, Milan, Italy), citric acid (Carlo Erba, Milan, Italy) and quinine hydrochloride (Sigma-Aldrich, St Louis, MO, USA) at three levels each were used [27 (link)]. The panelists were informed about the taste of each basic concentration. Then, a 10 mL quantity of high and low concentration for each taste solution was served blind. The panelists rinsed their mouths with filtered, de-ionized water between tests. De-ionized water was also used to prepare two blanks. Totaling ten samples (taste solutions and blanks) were presented in random order. The panelists had to identify the intensity (low and high) of each taste solution. The inability to recognize eight out of the 10 taste solutions was used as cutoff point for selection purposes [27 (link)]. Afterwards, panelists were trained for the scale use [28 ].
+ Open protocol
+ Expand
9

Bitter Taste Perception in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
L-Tryptophan, L-isoleucine, denatonium benzoate, quinine hydrochloride, caffeine, salicin, and sucrose were purchased from Sigma (St. Louis, MO, USA). Epigallocatechin gallate was provided by Taiyo Chemicals (Mie, Japan). All compounds were dissolved in deionized water to obtain the indicated concentrations.
The concentrations of bitter solutions used in this study are listed in Table 1. Pilot studies were conducted to determine the concentrations of each compound used in the two-bottle choice tests so that they spanned the range from indifference to marked avoidance [18 (link), 19 (link)]. The concentrations used for conditioned taste aversion (CTA) were set near the aversion threshold in naive animals (NE group). The concentrations used during prolonged exposure periods were the same as those for CTA except for CAF. Lower concentrations of CAF were used during taste aversion conditioning and prolonged exposures because mice exposed to high concentrations of CAF for a long time exhibited abnormal behaviors such as disruption of the day-night cycle and agitated and highly active states in a pilot study.
+ Open protocol
+ Expand
10

Bitter Taste Agonists in Chickens

Check if the same lab product or an alternative is used in the 5 most similar protocols
Three bitter taste agonists in chickens, Quinine sulfate (QS; Wako Pure Chemical Industries, Osaka, Japan), dextramethorphan hydrochloride (Dex; Sigma-Aldrich, St. Louis, MO) and quinine hydrochloride (QHCl; Sigma-Aldrich, St. Louis, MO) were used as bitter stimuli (Behrens et al., 2014 (link); Hirose et al., 2015 (link); Dey et al., 2017 (link)). For the behavioral experiment, QHCl was dissolved in normal tap water just before each experiment. For Ca2+ imaging, these compounds were dissolved in ultra-pure water to make stock solutions, stored at −20°C and diluted with a standard bath solution containing 140 mM NaCl, 5 mM KCl, 2 mM MgCl2, 2 mM CaCl2, 10 mM HEPES, and 10 mM glucose, adjusted pH value to 7.4 with NaOH just before each experiment.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!