Liz1200

The PCR products were purified using the Agencourt AMPure system (Beckman Coulter) and digested with 10 units of restriction enzyme HhaI or RsaI (New England Biolabs) in the manufacturer’s provided buffers 4 or 1, respectively. Digestion was carried out at 37°C for at least 16 hours and the restriction digests were purified using the Agencourt AMPure system. For each reaction, 2 μl purified restriction fragments were added to 6.7 μl formamide and 0.3 μl of the size standard LIZ1200 (Applied Biosystems). The fragments were analyzed by capillary gel electrophoresis (3730 DNA Analyzer, Applied Biosystems) using a 20s injection time, a 2.0 kV injection voltage and a 9 kV run voltage. The software GeneMapper (Applied Biosystems) was used to quantify the electropherogram data and to generate the T-RF profiles.

The universal primers 926r (5’-CCG TCA ATT CAT TTG AGT TT-3’) and 8f-6FAM (5’-AGA GTT TGA TCC TGG CTC AG-3’) were used for amplification of the bacterial 16S rRNA gene [6 (link)] following a previously reported protocol [25 (link)]. Every sputum DNA sample was subjected to three independent PCRs, and the resulting products were pooled and purified by GE Healthcare Sephadex G-100 for T-RFLP analysis. Two hundred nanograms of each purified PCR product were digested with 10 units of CfoI at 37°C for at least 5 h. Approximately 20 ng of digested PCR product were injected into an ABI 3730 DNA Analyzer (Applied Biosystems), using LIZ1200 (Applied Biosystems) as size standard.
Automated sequencing was performed by Genechron sequence service (Genechron Laboratory, Ylichron S.r.l., Rome, Italy).

The primers used for the amplification of mitochondrial-DNA-control-region-length polymorphisms have been described by Pun et al. [29 (link)]. Primer sequences: L15995 5′CTCCACTATCAGCACCCAAAG 3′; H16498 5′CCTGAAGTAAGAACCAGATG 3′.
The PCR mixture contained 1.25 μL of GoldStar 10× buffer (Promega, Madison, WI, USA), 10 μM L15995 + H16498 and 0.5 + 0.5 μL, and the primer L15995 was fluorescently labeled with 5-FAM, 0.25 μL (5 U/μL) of AmpliTag Gold DNA polymerase (Applied Biosystems, San Francisco, CA, USA), 10 pg of DNA, and H₂O to a final volume of 12.5 μL. The PCR program was as follows: 95 °C for 10 min, 32× (95 °C for 15 s, 55 °C for 30 s, 72 °C for 1 min), and 72 °C for 30 min.
PCR was performed using a MasterCycler Nexus gradient thermocycler (Eppendorf, Germany). The resulting amplicons were visualized using capillary electrophoresis (SeqStudio 3200 Genetic Analyzer; Applied Biosystems, USA) under the following parameters: G5 matrix, 12 µL formamide, 0.4 µL LIZ 1200 (Applied Biosystems, USA), 1 µL of PCR product. Raw data processing was performed using GeneMapper5 (Applied Biosystems, USA).