EZ-Magna ChIP G Chromatin Immunoprecipitation Kit (Millipore, USA) was applied in this assay. In short, formaldehyde was used to treat cells for 10 min. The crosslinked chromatin was prepared and subsequently sonicated to fragments 200 to 400-bp in length, and were immunoprecipitated with IgG antibody (Negative control, Abcam) or SP1 antibody (Abcam) for 2 h (4°C). The precipitated chromatin DNA was eluted, reversed cross-links and treated with proteinase K before qRT-PCR analysis.
Sp1 antibody
Manufactured by Abcam
Sourced in United States
The Sp1 antibody is a tool used in research applications to detect and analyze the Sp1 transcription factor. Sp1 is a protein that binds to specific DNA sequences and regulates the expression of various genes. The Sp1 antibody can be used in techniques such as Western blotting, immunohistochemistry, and immunoprecipitation to study the localization, expression, and interactions of the Sp1 protein.
Automatically generated - may contain errors
Lab products found in correlation
Ez magna chip g chromatin immunoprecipitation kit, by Merck Group (1 mentions)
Lightshift chemiluminescent emsa kit, by Thermo Fisher Scientific (1 mentions)
Ne per nuclear and cytoplasmic extraction reagent, by Thermo Fisher Scientific (1 mentions)
Protein a sepharose beads, by Merck Group (1 mentions)
P300 antibody, by Abcam (1 mentions)
Mbd2 antibody, by Abcam (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Bioruptor plus, by Diagenode (1 mentions)
P53 antibody, by Cell Signaling Technology (1 mentions)
Dynabeads, by Beyotime (1 mentions)
Fn antibody, by Abcam (1 mentions)
Chip assay kit, by Beyotime (1 mentions)
8 protocols using sp1 antibody
1
ChIP-qRT-PCR Chromatin Immunoprecipitation
2
EMSA Protocol for Analyzing Sp1 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EMSA was conducted as described previously, with minor changes [15 (link), 16 (link)]. Nuclear proteins were extracted from HLE B3 cells using NE-PER nuclear and cytoplasmic extraction reagents (Pierce Biotechnology, Rockford, IL, USA). Methylated and wild-type oligonucleotides, were purchased from Shenggong Technologies, Inc. (China). These included the wild-type SP-1 consensus binding sequence of the CRYAA promoter (5′ –GGCTGGGCGT CCA-3′) and the methylated Sp1 consensus binding sequence (5′ –GGCTGGGC m GT CCA-3′). The Sp1 consensus binding site is underlined. All listed oligonucleotides included antisense oligonucleotide strands. In methylated oligonucleotides, the antisense oligonucleotide strands were methylated at the cytosine corresponding to that of the sense strand. EMSA probes were synthesized as double strands after pair annealing and 3′-end-labeled with biotin (Invitrogen). Unlabeled oligonucleotides with identical sequences were used as competitors. The EMSA was performed using the LightShift Chemiluminescent EMSA kit (Pierce Biotechnology), following the manufacturer’s protocol. For supershift experiments, Sp1 antibody (Abcam) was added to the reaction solution 30 min prior to the addition of the probes. The densities (total gray) of the bands were calculated using Glyko Bandscan 5.0 software (ProZyme, Hayward, CA, USA).
3
Chromatin Immunoprecipitation of Transcription Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HK-2 and MKN45 cells were cross-linked by incubation in 1% formaldehyde-containing medium for 10 mins at 37°C, and sonicated to soluble chromatin. Sp1 antibody (Abcam, Cambridge, MA, USA), MBD2 antibody (Abcam), MeCP2 antibody (Abcam), MBD3 antibody (Abcam), p300 antibody (Abcam), Di-acetyl H3 antibody (Abcam) and Tetra-acetyl H4 antibody (Abcam) were used to precipitate DNA fragments bound by the corresponding elements. The protein-DNA complex was collected using protein A Sepharose beads (Millipore, Darmstadt, Germany) followed by the processes of elution and reverse crosslink. After protease K treatment (Millipore), samples were extracted with phenol/chloroform and precipitated with ethanol. Recovered DNA was resuspended in TE buffer (Millipore) and amplified by PCR. Primers designed for the gene promoter of Ki-67 were as follows: forward 5′-ATGCGTGAGTGGCTCGCCC-3′, reverse 5′-ATGCGTGAGTGGCTCGCCC-3′ (Ibsbio).
4
Chromatin Immunoprecipitation for GPER Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MM cells (1.5 × 107) were crosslinked in 1% formaldehyde, lysed, and sheared by sonication for 10 cycles (30 s each) on a cold block with intervals of 90 s of cooling by using the Bioruptor Plus (Diagenode, Denville, NJ, USA). Chromatin was divided into equal amounts of immunoprecipitation with Sp1 antibody (Abcam, cat#24543), or rabbit IgG as a negative control (Santa Cruz Biotechnology, Dallas, TX, USA). Chromatin extracts were incubated on a rotator with 20 µL of ChIP Grade Protein A/G Plus Agarose for 3 h at 4 °C. Bound agarose beads were then harvested by centrifugation (12,000 rpm, 15 s) and washed. The precipitated protein-DNA complexes were separated from beads and incubated twice at 65 °C for 1.5 h with NaCl and Proteinase K to revert cross-links. Purified DNA was subjected to qPCR using GoTaq qPCR Master Mix (Promega, Madison, WI, USA). Primer sequences for qPCR were the following: GPER promoter Sp1 binding site 1- Fw AGTAGGTCTTGGAGACGGAAGT and GPER promoter Sp1 binding site 1- Rev: CAGCATAGAGTCAGCGGATCG.
5
Chromatin Immunoprecipitation of Sp1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As described by Zhang et al. [30 (link), 31 ], chromatin from cell cultures at 0 and 24 h was prepared. Chromatin was immunoprecipitated with 4 μg of Sp1 antibody (Abcam, Britain). In parallel immunoprecipitation procedures, 4 μg of Gaq antibody (Santa Cruz Biotechnology, USA) was used as a control. Precipitated DNA was amplified for 25 cycles. The promoter-specific forward primer is CTGTTTTCAGTGCCAACT, and the reverse primer is CATGGGGCCCCGTCGGCCGCTG.
6
Immunoprecipitation of p53 Protein
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sp1 antibody (Abcam, 10 μg) was diluted in 400 μL lysate/washing buffer (25 mM Tris [pH 7.4], 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 1% [v/v] Nonidet P-40, 5% [v/v] glycerol, and 0.25 mM phenylmethylsulfonyl fluoride). Then, 50 μL of 5% (w/v) bovine serum albumin-blocked Dynabeads (Beyotime, Shanghai, People’s Republic of China) were added, and the mixture was incubated with gentle rotation for 2 hours at room temperature. After the bead–antibody complexes had been centrifuged, they were collected and washed three times. Then, 200 μg of nucleoproteins were added, and the mixture was incubated with gentle rotation overnight at 4°C, followed by centrifugation. After the precipitates had been washed five times, they were suspended in 50 μL of sodium dodecyl sulfate loading buffer and denatured by heating. Finally, the samples were separated using sodium dodecyl sulfate polyacrylamide gel electrophoresis and analyzed using a p53 antibody (Cell Signaling Technology, 1:1,000) and Western blot assay.
7
Renal Tissue Histology and IHC Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fresh kidney tissue was embedded in paraffin, sectioned (2-3 µm thickness), and dried in an oven at 60°C for 120 min prior to use. Following deparaffinization and hydration, the sections were stained with hematoxylin-eosin (HE) and a light microscope was used to visualize the morphology of the renal tissue. For IHC staining, sections were placed in citrate buffer (10 mM citric acid, pH 6.0) and heated (high heat for 8min, medium heat for 20min) in a microwave oven for antigen retrieval. Next, 3% H2O2 was added dropwise to block endogenous peroxidase activity. Each section was then incubated overnight at 4°C with an optimized concentration of Sp1 antibody (Abcam, 1:400), CoL-I (Affinity, 1:150), and Fn antibody (Abcam, 1:200). For the negative control, we used non-immune IgG instead of the primary antibody. The next morning, sections were washed and then incubated for 1 h at room temperature with HRP-labeled biotinylated goat anti-rabbit IgG. Positive antibody binding was subsequently detected with a diaminobenzidine (DAB) kit. Finally, representative images were acquired at a magnification of 400×.
8
Sp1 ChIP on srebf1 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP experiments were performed as the instruction manual of Chip assay kit (Beyotime, China). Hep1-6 cells were sonicated and immunoprecipitated using 4µg Sp1 antibody (Abcam, Cambridge, MA) or IgG. The sheared DNA was purified with a DNA extraction kit and amplified by quantitative real-time PCR analysis. The primer sequences of srebf1 promoter were 5'-CCA TCC CTG GCC CTT TAA TCT AAC GA-3' (sense) and 5'-TTC GGA CTA GGC CCA CGT TAA GGA AA-3' (anti-sense).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!