Total RNA was extracted from 10 glioma and 6 adjacent brain tissue samples using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA). A reverse transcription kit (Vazyme, Wuhan, China) was used to reverse transcribe cDNA, and then real‐time polymerase chain reaction (PCR) was performed with SYBR Green real‐time PCR kit, with GAPDH as the internal reference control. The PCR cycle conditions were as follows: 95 °C for 2 min, then 94 °C for 20 s, 58 °C for 20 s, and 72 °C for 30 s, for a total of 40 cycles. All RT‐qPCR reactions were independently performed three times. The tissue samples and primer sequences of the matrisomes are shown in Tables S3 and S4 .
Sybr green real time pcr kit
Manufactured by Vazyme
Sourced in China
The SYBR‑Green Real‑Time PCR kit is a reagent system used for quantitative real-time PCR analysis. It contains a SYBR‑Green dye that binds to double-stranded DNA, enabling the detection and quantification of target DNA sequences during the PCR amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Linegene9660 system, by Thermo Fisher Scientific (2 mentions)
Prime rt reagent kit, by Vazyme (2 mentions)
Reverse transcription kit, by Vazyme (1 mentions)
High capacity cdna reverse transcription kit, by Vazyme (1 mentions)
Minioption thermocycler, by Bio-Rad (1 mentions)
7 protocols using sybr green real time pcr kit
1
Quantitative Analysis of Matrisome Genes in Glioma
2
Gene Expression Analysis in Rat Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rats in both groups (n = 6) were deeply anesthetized with sodium pentobarbital (200 mg/kg, i.p.) on PODs 7, 14, 21, and 28. Total RNA was extracted in TRIzol reagent (Invitrogen, TX, United States, Cat# 15596018). Subsequently, a High-Capacity cDNA Reverse Transcription Kit (Vazyme, Nanjing, China, Cat# R223) was used to convert RNA into cDNA, while a SYBR-Green Real-Time PCR Kit (Vazyme, Cat# Q311) and a Bio-Rad MiniOption thermocycler (Bio-Rad, CA, United States) were used for detection. Primer sequences are provided in Table 1 . The relative expression levels of RNA were evaluated using the 2−ΔΔCt method.
3
Quantitative Analysis of IRAK4 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol reagent (Invitrogen) was used to purify total RNA from peripheral blood lymphocytes in accordance with the manufacturer's protocol. Peripheral blood was collected on the second day after admission, and peripheral blood lymphocytes were extracted according to the manufacturer's instructions (Solarbio). A QuickDrop spectrophotometer was used to assess the concentration and quality of the RNA. Each sample was reverse‐transcribed into cDNA and analyzed using the SYBR‑Green Real‑Time PCR kit (Vazyme). The 2 ‐ ∆ ∆ C q 1 .
4
Quantitative PCR Analysis of Autophagy Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was accomplished by TRIzol reagent (Invitrogen) and the reverse transcription with Prime RT reagent kit (Vazyme). Quantitative PCR was performed utilizing SYBR Green real–time PCR kit (Vazyme). The relative mRNA levels were computed with the ΔCt method. PCR primer sequences are shown in Table 1 .Table 1
Primer sequences of the targeted gene
| Primer | Sequence (5’ to 3’) |
|---|---|
| HIF1A_Fw | CACCACAGGACAGTACAGGAT |
| HIF1A_Rv | CGTGCTGAATAATACCACTCACA |
| Beclin–1_Fw | ACCTCAGCCGAAGACTGAAG |
| Beclin–1_Rv | AACAGCGTTTGTAGTTCTGACA |
| ATG5_Fw | TTGACGTTGGTAACTGACAAAGT |
| ATG5_Rv | TGTGATGTTCCAAGGAAGAGC |
| ATG7_Fw | GATCCGGGGATTTCTTTCACG |
| ATG7_Rv | CAGCAATGTAAGACCAGTCAAGT |
| ATG12_Fw | TAGAGCGAACACGAACCATCC |
| ATG12_Rv | CACTGCCAAAACACTCATAGAGA |
| β–Actin_Fw | TCACCCACACTGTGCCCA |
| β–Actin_Rv | ATGTCACGCACGATTTCCC |
5
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA extraction was harvested by using TRIzol reagent (Invitrogen). Then the RNA extraction was undergoing reverse transcription by using Prime RT reagent kit (Vazyme). PCR primer sequences (5'to3') are recorded as follows: human Gapdh-F primer sequence CCACATCGCTCAGACACCAT; human Gapdh-R primer sequence TGACAAGCTTCCCGTTCTCA; human Linc00969-F primer sequence ACGGATCACCACTGCAAGAG; human Linc00969-R primer sequence TAGGTGGAATCGGGCCTGTA; human HUR-F primer sequence GAAGACCACATGGCCGAAGA; human HUR-R primer sequence TGGTCACAAAGCCAAACCCT. Quantitative PCR was performed by using SYBR Green real-time PCR kit (Vazyme).
6
Quantitative RT-PCR for Enterovirus 71
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral blood lymphocytes were extracted according to the manufacturer's instructions (Solarbio) on the second day after admission. Total RNA was purified by TRIzol reagent (Invitrogen) in accordance with the manufacturer's protocol, and the concentration and quality of the RNA were assessed by A QuickDrop spectrophotometer. The SYBR‑Green Real‑Time PCR kit (Vazyme) was used to reverse‐transcribe the mRNA into complementary DNA (cDNA). A standard curve for calculating the copy numbers of viral RNA was built by a series of dilutions (1 × 107, 1 × 106, 1 × 105, and 1 × 104 copies/μl of a DNA fragment) in various samples. The ligation cycling step consisted of 95°C for 15 min and 40 cycles of thermal cycling at 95°C for 10 s and 60°C for 60 s. Quantitative RT‐PCR was performed using a Linegene9660 system (Thermo Fisher Scientific). The specific primers used were as follows: EV71‐S: GTTCTTAACTCACATAGCA, EV71‐A: TTGCAAAAACTGAGGGTT (Table 1 ).
7
RT-qPCR Gene Expression Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative-polymerase chain reaction (RT-qPCR) was used to determine gene expression and was carried out by quantitative thermal cycler (BIO- RAD, Hercules, CA, USA) using the SYBR Green real-time PCR kit (Vazyme, Nanjing, China). Primers were designed by Primer Premier 5.0 (Table S1 ). β-actin was selected as the internal control. During the experiment, the melt curve analysis of each gene was analyzed to confirm that there was only one single peak in the thermal decomposition. Gene expression was analyzed using the 2−ΔΔCt method [27 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!