Improm iitm reverse transcription system kit

Total RNA was isolated from P. major muscles using TriReagent (Molecular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer’s recommended protocol. DNA was removed by incubating the isolated RNA with DNase I (Thermo Scientific, Inc., Rockford, IL, USA). Total RNA samples were subsequently purified using a GeneJet RNA Cleanup and Concentration Micro kit (Thermo Scientific, Inc.). Total RNA concentration and quality were quantified using a Nanodrop spectrophotometer (model 2000, Thermo Scientific, Inc., Wilmington, DE, USA), and its integrity was further determined using an agarose gel electrophoresis. Total RNA was then proceeded to cDNA synthesis using an oligo(dT) as a primer and an ImProm-IITM Reverse Transcription System kit (Promega Corporation, Madison, WI, USA). The amount of the synthesized cDNA was determined using a Nanodrop spectrophotometer.

Samples for RNA extraction and qPCR analysis were taken every day at the same time from two bioreactors for a period of 5 days. Volumes of 20 ml were sampled and centrifuged at 4000 rpm for 3 min. The pellet was washed in 0.9% RNAse-free NaCl and frozen in liquid nitrogen. It was thereafter stored at -80°C until extraction. RNA was extracted from the pellets as described previously (Collart and Oliviero, 1993 (link)). RNA was DNAse treated with added RiboLock RNAse Inhibitor according to protocol provided by Promega (Fitchburg, Wisconsin). Total RNA was quantified using a Nanodrop^TM 1000 Spectrophotometer, and the integrity of total RNA was checked on a 1.2% agarose gel both before and after DNAse treatment. RNA was of a good quality and was found to be free of genomic DNA. RNA (200 ng) was reverse transcribed to cDNA using PCR techniques according to directions supplied by the Promega ImProm-II^TM Reverse Transcription System kit (Fitchburg, Wisconsin).

The total RNA was extracted from 50 mg of the larvae, testes, or ovaries using TRIzol reagent (Invitrogen) and subsequently treated with RNase-free DNase I (Promega) according to the manufacturer’s instructions. Subsequently, first-strand cDNA was synthesized from 1 µg of the total RNA using an ImProm-II^TM Reverse Transcription System kit (Promega).

RNA from total blood was extracted using Trizol LS (GE Healthcare, USA) following the manufacturer's instructions. The RNA was submitted to reverse transcription using the ImProm-II (TM) Reverse Transcription System kit (Promega, USA). CTSZ and housekeeping genes were amplified using 2 µL of cDNA of each sample previously diluted 1:15, 5 µL of Power SYBR Green Master Mix (2X) (Thermo Scientific, USA), and 1.5 µL of primers sense and antisense (6 µM). The samples were amplified in the Applied Biosystems^® 7500 Real-Time PCR System (Life Technologies, USA) for 40 cycles of 15 s at 95°C, followed by 60 s at 60°C. The following primer sequences were used: CTSZ sense: 5′ CATCCCTGACGAGACCTG 3′, CTSZ antisense: 5′ GCATGTCCCACATTGGTTAAA 3′; ribosomal protein 13a (RPL13a) sense: 5′ CCACCCTGGAGGAGA 3′ and RPL13A antisense: 5′ CCTGTTTCCGTAGCCTCAT 3′. All experiments were performed in triplicate for each sample. CTSZ mRNA expression was firstly normalized by the housekeeping gene RPL13a (2^-ΔCt) and then corrected by the CTSZ mRNA expression from the healthy control group (2^-ΔCt). RPL13a was previously used to correct CTSZ expression from the control group.

The first-strand cDNA was synthesized from 1 µg of the total RNA extracted from the gills, heart, intestine, kidney, liver, muscle, skin, and stomach using the ImPromIITM Reverse Transcription System Kit (Promega). Two pairs of gene-specific primers were designed to determine the expression levels of ddx4 (Tpe-ddx4F2 and Tpe-ddx4R3) and dnd1 (Tpe-dndF1 and Tpe-dndR4). The beta actin gene (actb) served as an internal control, and a pair of primers (β-actinF and β-actinR; Table 1) was used. Reverse-transcriptase (RT)-PCR analysis was performed in a total volume of 10 µL consisting of 1 µL of cDNA template, 1 µL of dNTP mix (2.5 mM each), 10 pmol of each primer, 2.5 mM MgCl₂, 5X GoTaq Flexi buffer, and 0.25 U GoTaq DNA polymerase (Promega). The RT-PCR analysis was performed with an initial denaturation at 95 °C for 5 min, followed by 35 reaction cycles of 45 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C. The final elongation step was carried out at 72 °C for 5 min. The plasmids p3-ddx4, pdnd, and pActin, which contain partial cDNA of actb [39 (link)], were used as positive controls to determine ddx4, dnd1, and actb. The PCR products of ddx4, dnd1, and actb were verified using agarose gel electrophoresis and RedSafe™ Nucleic Acid Staining (JH Science, iNtRON Biotechnology, WA, USA).