The largest database of trusted experimental protocols

Ag14361

Manufactured by Selleck Chemicals
Sourced in United States

AG14361 is a multi-purpose laboratory equipment designed for general use in scientific research and analytical applications. It performs essential functions to support various experimental and testing procedures. The product specifications and core capabilities are provided without interpretation or extrapolation on intended use.

Automatically generated - may contain errors

8 protocols using ag14361

1

Evaluation of Small Molecule Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMN673 was obtained from Medivation, a collaborator of NCI. The Parp1/2 inhibitor PJ34 (ref. 29 (link); Calbiochem) was used at 5 μmol/L final concentration. 8-(4-Dibenzothienyl)-2-(4-morpholinyl)-4H-1-benzopyran-4-one (NU7441, Tocris), a highly specific DNA-PKcs inhibitor (30 (link)), was used at 5 μmol/L final concentration. Rad51 inhibitor B-02 (ref. 31 (link); Merck-Millipore) was used at 25 μmol/L final concentration. AG14361 (specific Parp1 inhibitor; ref. 32 (link)), olaparib (Parp1/2 inhibitor), ME0328 (Parp3 inhibitor; ref. 33 (link)), and UPF1069 (Parp2 inhibitor; ref. 34 (link)) were purchased from Selleckchem and used at 400 nmol/L (AG14361), 1 μmol/L (UPF1069) or 3 μmol/L (all others).
+ Open protocol
+ Expand
2

PARP-1 Inhibition in Lens Cultures

Check if the same lab product or an alternative is used in the 5 most similar protocols
PARP-1 was chemically inhibited with AG14361 (Selleck Chemicals, Houston, TX, USA), a potent and specific inhibitor of PARP-1 [34] (link), [35] . AG14361 was diluted in DMSO (Fisher Scientific, Loughborough, UK) upon delivery to produce a 25 mM stock which was frozen at −80 °C. All experiments therefore also contained a dimethyl sulfoxide (DMSO) control diluted to the same concentration. AG14361 was freshly diluted in serum-free EMEM and added to FHL124 cells cultures to give a final concentration of 1 µM. For experiments using whole human lenses, freshly diluted AG14361 was added to whole human lens cultures to give a final concentration of 10 μM.
+ Open protocol
+ Expand
3

Nurr1 Protein Interaction and Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Angiotensin II was purchased from Sigma-Aldrich (St Louis, MO, USA). AG14361 was purchased from Selleck (Houston, TX, USA) and dissolved in Dimethyl sulfoxide (DMSO). siRNAs were purchased from GE Healthcare (Uppsala, Sweden). Following antibodies were used: anti-Nurr1/Nur77 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA, sc-990) and anti-Nurr1 (Santa Cruz Biotechnology, Inc., sc-991) for RIME, anti-Nurr1 (Perseus Proteomics, Tokyo, Japan, PP-N1404-00), anti-PARP1 (Transduction Laboratories, Lexington, KY, USA, P76420), anti-FLAG tag (Sigma-Aldrich, F1804) and anti-HA tag (ICL, Portland, OR, USA, RHGT-45A-Z) for western blot, anti-Nurr1 (Santa Cruz Biotechnology, Inc., sc-991) for immunoprecipitation, anti-Nurr1 (Atlas Antibodies, Bromma, Sweden, HPA000543) and anti-PARP1 (Transduction Laboratories, P76420) for immunostaining, Alexa Fluor 488 goat anti-rabbit IgG (H + L) (Thermo Fisher Scientific, Pittsburgh, PA, USA, A11034) and Alexa Fluor 594 goat anti-mouse IgG (H + L) (Thermo Fisher Scientific, A11032) for 2nd antibodies for immunostaining. For immunoprecipitation of FLAG-tagged protein, Anti-FLAG M2 affinity agarose gel (Sigma-Aldrich, A2220) were used.
+ Open protocol
+ Expand
4

PARP Inhibitor Compounds Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The PARP inhibitors used in this study were purchased from Selleckchem (Houston, TX, USA) with the following names and catalog numbers: A-966492 (catalog number S2197), AG14361 (catalog number S2178), AZD2461 (catalog number S7029), E7449 (catalog number S8419), G007-LK (catalog number S7239), Niraparib (MK-4827; catalog number S2741), NMS-P118 (catalog number S8363), NU1025 (catalog number S7730), Olaparib (AZD2281, Ku-0059436; catalog number S1060), PJ34-HCl (catalog number S7300), Rucaparib (AG-014699, PF-01367338; catalog number S1098), Talazoparib (BMN673; catalog number S7048), and UPF1069 (catalog number S8038). Stock solutions were dissolved in dimethyl sulfoxide (DMSO) according to the manufacturer’s protocol to a concentration of 10 mM and stored at −20 °C. Table 1 lists the PARP inhibitors used in this study and their proposed targets.
+ Open protocol
+ Expand
5

Sensitizing AML to Apoptosis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary human AML cells were cultured in RPMI1640 supplemented with 10%
FCS and cord blood cells in X-Vivo 20 (Lonza, Basel, Switzerland) supplemented
with 100 ng/ml SCF, 100 ng/ml TPO, 100 ng/ml Flt3-L and 60 ng/ml IL-3 (all
Peprotech, Rocky Hill, NJ, USA). AG-14361 (20 μM, Selleckchem, Munich,
Germany), DMSO (0.2%), veliparib (10 μM, Selleckchem, Munich, Germany),
azacytidine (5μM, Sigma-Aldrich), all-trans retinoic acid (ATRA, 1
μM, Sigma-Aldrich), valproic acid (VPA, 2 μM, Sigma-Aldrich), or
NKG2D-Fc or isotype control (10μg/ml) (AML cells: 24h, cord blood cells:
48h) was added. Transfection with individual or scrambled PARP1, or with
scrambled non-coding control Silencer Select small interfering (siRNAs)
(LifeTechnologies, Carlsbad, CA, USA) using Lipofectamine RNAiMAX reagent
(LifeTechnologies) was perfomed. Following siRNAs were used: s1097 sense:
GGUGAUCGGUAGCAACAAATT; antisense: UUUGUUGCUACCGAUCACCGT; s1098 sense:
CCAUCGAUGUCAACUAUGATT; antisense: UCAUAGUUGACAUCGAUGGGA; s1099 sense:
GCAGCUUCAUAACCGAAGATT; antisense: UCUUCGGUUAUGAAGCUGCTT. Annexin V/7-AAD (BD
Biosciences, used according manufacturer’s protocol) was used to
distinguish live and apoptotic cells.
+ Open protocol
+ Expand
6

In Vitro Parkinson's Modeling

Check if the same lab product or an alternative is used in the 5 most similar protocols
The medium was removed and replaced with fresh medium containing or not, either 1-methyl-4-phenyl-pyrididium (MPP+, at 2, 4, 8 and 16 μmol/L), a metabolite of MPTP, 6OHDA (at 5, 10, 20 and 30 μmol/L) or rotenone (0.1, 1, 10 and 20 nmol/L) (all from Sigma Aldrich) at different concentrations, for different times of incubation (6 wells per condition). Here, these three toxins were used to mimic in cell cultures in vitro cytopathic effects observed in the brains of PD-suffering patients. They were dissolved in the defined culture media mentioned above. Involvement of poly-ADP-ribose polymerase (PARP-1), a partner involved in necroptosis, was assessed using AG14361 (Selleckchem, Houston, Texas, USA), a specific inhibitor of PARP-1 (1 μmol/L, added to the cultures 1 h before DA-toxins).
+ Open protocol
+ Expand
7

Ovarian Cancer Cell Line Cultivation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The human ovarian serous cystadenocarcinoma cell lines UWB1.289, SNU-251, A2780 and SKOV3 were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 μg/ml streptomycin (all from Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in a humidified incubator with 5% CO2 at 37° C. Oxamate (a specific LDH-A inhibitor), AG14361 (a specific PARP1 inhibitor) and olaparib (a PARP1/2 inhibitor) were obtained from Selleck Chemicals (Houston, TX, USA). The study was reviewed and approved by the Institutional Review Board and the Research Ethics Committee of Shanghai General Hospital.
+ Open protocol
+ Expand
8

Ovsaho Cell Dose-Response and Combination Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ovsaho cells were obtained from JCRB (Japanese Collection of Research Bioresources Cell Bank) cell bank (NIBIOHN, Cell No. JCRB 1046) and grown in MCDB105/199 medium with 10% FBS (Fisher, #10438026) and substituted with 1% Penicillin-Streptomycin. All cells were free of Mycoplasma and their identity was verified by whole exome sequencing at the Broad Institute. For dose-response curves, cells were treated for 72 h with DMSO or the indicated doses of the PARP1 inhibitor AG-14361 (Selleckchem, #S2178), FAS/FASN inhibitor TVB-2640 (Selleckchem, #S9714), Bortezomib (Selleckchem, #S1013), proTAME (Selleckchem, #S9605), GC7 (Sigma Aldrich #259545). In combination assays, inhibitor concentrations were combined in a 1:1 ratio for indicated total concentration. Cell viability was measured using the software in a live-imaging IncuCyte station by counting live cells. Live cells were labeled by adding the Incucyte NucLight Rapid Red (NRR) Reagent (Essen Bioscience, #4717, 1:4000) to the medium. Datapoints of three biological experiments and three technical replicates (total n = 9) were merged and fitted using a non-linear log(inhibitor) versus normalized response with variable slope for dose-response curves using Prism (GraphPad). Combination Index (CI) was calculated based on Chou-Talaly method [53 (link)].
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!