Bigdye terminator v3.1 sequencing chemistry

Human DNA was extracted using cell lysis buffer containing 100 mM Tris-Cl (pH 7.6), 40 mM EDTA (pH 8.0), 50 mM NaCl, 0.2% SDS and 0.05% Sodium azide. After lysis, a salt solution (1M NaCl final concentration) and ethanol precipitation protocol was used to purify DNA. Genotyping of SNP rs7216389 and SNP rs12936231 was done by amplifying with Biotaq DNA polymerase (Bioline) the surrounding region using primers 5’-GTGCCTGGCATACATTCTAACTGC-3’and 5’-AGCCCTGCCTCCAAAACCTAG-3’; and primers 5’-AGTATGTAGTTGACCTTAGCCTG-3’ and 5’-GGTCCAAGTGCTGAATTCCA-3’, respectively. Cycle sequencing was performed on purified PCR products with an Applied Biosystems BigDye terminator v3.1 sequencing chemistry and run on an ABI 3100 (Applied Biosystems, California, USA) genetic analyzer. The sequences were analyzed with DNAstar Lasergene 11 software.

All UF tissue samples were screened for MED12 mutations. Genomic DNA was extracted from UF tissue samples with FastDNA Kit (MP Biomedicals LLC, Solon, OH, USA) (fresh frozen), QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) or Quick-DNA FFPE Miniprep (Zymo research, Irvine, CA, USA) (paraffin embedded archival samples) and screened for the UL causing MED12 exon 1 and 2 mutations by Sanger sequencing. The following 5′ to 3′ primers were used on fresh frozen tissue samples CCTCCGGAACGTTTCATAGAT (MED12 Ex1 forward) and TTCGGGACTTTTGCTCTCAC (MED12 Ex1 reverse), and GCCCTTTCACCTTGTTCCTT (MED12 Ex2 forward) and TGTCCCTATAAGTCTTCCCAACC (MED12 Ex2 reverse) and for paraffin embedded archival samples: CCCCTTTTCGGCTCCCTC (MED12 Ex1 forward) and GTCAGTGCCTCCTCCTAGG (MED12 Ex1 reverse), and GCCCTTTCACCTTGTTCCTT (MED12 Ex2 forward) and AAGCTGACGTTCTTGGCACT (MED12 Ex2 reverse). MED12 NM_005120.2 was used as a reference sequence.
PCR products were sequenced using BigDye Terminator v.3.1 sequencing chemistry (Applied Biosystems, Foster City, CA, USA) on an ABI3730 Automatic DNA Sequencer or sent for sequencing to Eurofins Genomics Germany GmbH (Ebersberg, Germany). Sequence chromatograms were analyzed manually and with Mutation Surveyor software (Softgenetics, State College, PA, USA).

Candidate variants in AARS and ESRP2 were validated and screened in 21 additional family members of generation IV using Sanger sequencing. Regions containing the candidate variants were amplified by polymerase chain reaction (PCR) with Roche FastStart PCR Master Mix (Roche Diagnostics Corp) and sequenced with Applied Biosystems BigDye terminator v3.1 sequencing chemistry in an ABI3730XL genetic analyzer as per manufacturer’s instructions (Applied Biosystems). Primers are available upon request. The sequences were analyzed in Sequencher software v4.2 (Gene Codes) using ENSG00000090861 and ENSG00000103067 as reference sequences for AARS and ESRP2, respectively.