PanC1 and AsPC1 were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin-streptomycin. The pLKO.1 shRNAs were purchased from Thermo Scientific. The shRNAs targeting EZH2 were CCGGCAACAAGATGAAGAGCACCAACTC and GAGTTGGTGCTCTTCATCTTGTTGTTTTT. The shRNA targeting Ring1B was ATTGTGCTTGTTGATCCTGGC. The stable shRNA-knocked down cells were constructed by viral infection and selected with puromycin.
Plko 1 shrnas
Manufactured by Thermo Fisher Scientific
PLKO.1 shRNAs are a set of plasmid-based vectors designed for the expression of short hairpin RNA (shRNA) sequences. These vectors are commonly used in research applications to achieve targeted gene knockdown through RNA interference (RNAi) technology. The core function of PLKO.1 shRNAs is to provide a platform for the stable and efficient delivery of shRNA constructs into cells, enabling the study of gene function and the exploration of potential therapeutic targets.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using plko 1 shrnas
1
Knockdown of EZH2 and Ring1B in PanC1 and AsPC1 cells
2
Molecular Cloning and Analysis of NAMPT-AS and NAMPT
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA of NAMPT-AS and NAMPT were cloned into the pcDNA3.1-Myc/His vector (Invitrogen), and verified by sequencing. A set of pLKO.1 shRNAs targeting human NAMPT was purchased from Thermo Fisher Scientific. miR-548b-3p mimics, siRNAs against NAMPT-AS, POU2F2 were purchased from Gene-Pharma. Transfection was performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. To establish stable NAMPT-AS/NAMPT overexpression and NAMPT knockdown cell lines, cells were selected with 0.3 mg/mL G418 for pcDNA3.1 based-vectors or 0.5 mg/mL puromycin for PLKO.1based vectors.
qPCR, Western blot analysis, IHC, and immunofluorescence qPCR, Western blot analysis, IHC, and immunofluorescence were performed according to standard protocols as previously described (16) . Primers were listed in Supplementary Table S1. All antibody information was listed in Supplementary Table S2.
qPCR, Western blot analysis, IHC, and immunofluorescence qPCR, Western blot analysis, IHC, and immunofluorescence were performed according to standard protocols as previously described (16) . Primers were listed in Supplementary Table S1. All antibody information was listed in Supplementary Table S2.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!