Total RNA from wild-type and Tshz3 mutant brains at E18.5 was prepared using Rneasy Plus Universal Mini Kit gDNA eliminator (Qiagen™) and first strand cDNA was synthesized using iScript Reverse Transcription Supermix kit (Bio-RAD™). Real-time PCR was performed on a CFX96 QPCR detection system (Bio-RAD™) using SYBR® GreenER™ qPCR SuperMixes (Life Technologies™). RT-qPCR conditions: 40 cycles of 95 °C for 15s and 60 °C for 60 s. Analyses were performed in triplicate. Transcript levels were first normalized to the housekeeping gene Gapdh, and then normalized to their respective control group. Primer sequences used for Sybr qPCR are listed in Supplementary Table 8 . Statistical analysis was performed by unpaired t-test by using the qbasePLUS software version 2 (Biogazelle). A p- value <0.05 was considered to be significant.
Sybr greener qpcr supermixes
Manufactured by Thermo Fisher Scientific
Sourced in United States
SYBR® GreenER™ qPCR SuperMixes are a set of ready-to-use solutions for real-time quantitative PCR (qPCR) analysis. They contain all the necessary components for amplification and detection, including the SYBR® Green I dye for fluorescent monitoring of DNA synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy plus universal mini kit gdna eliminator, by Qiagen (3 mentions)
Cfx96 qpcr detection system, by Bio-Rad (3 mentions)
Iscript reverse transcription supermix kit, by Bio-Rad (3 mentions)
Qbaseplus software version 2, by CellCarta (2 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Trypsin, by Corning (1 mentions)
Horseradish peroxidase hrp conjugated secondary antibody, by Santa Cruz Biotechnology (1 mentions)
Penicillin streptomycin, by Corning (1 mentions)
Tris buffered saline tween20 tbst, by Merck Group (1 mentions)
Dulbecco s phosphate buffered saline, by Corning (1 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Ecl chemiluminescence substrate, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
P38 mapk, by Cell Signaling Technology (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Ripa buffer, by Merck Group (1 mentions)
Protease inhibitor cocktail, by Merck Group (1 mentions)
Rna 6000 nano labchip kit, by Agilent Technologies (1 mentions)
4 protocols using sybr greener qpcr supermixes
1
Tshz3 Mutant Brain Gene Expression Profiling
2
Quantification of Tshz3 Gene Expression in Mouse Brains
3
Tshz3 Transcript Profiling in Cerebral Cortex
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from control and Tshz3 mutant (P28) cerebral cortex was prepared using RNeasy Plus Universal Mini Kit gDNA eliminator (Qiagen™) and first-strand cDNA was synthesized using iScript Reverse Transcription Supermix kit (Bio-RAD™). No blinding was done. Real-time quantitative PCR (RT-qPCR) was performed on a CFX96 qPCR detection system (Bio-RAD™) using SYBR®GreenER™ qPCR SuperMixes (Life Technologies™). RT-qPCR conditions: 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Analyses were performed in triplicate. Transcript levels were first normalized to the housekeeping gene Gapdh. Primer sequences used for RT-qPCR: Gapdh Forward: 5′ GTCTCCTGCGACTTCAACAGCA 3′; Gapdh Reverse: 5′ ACCACCCTGTTGCTGTAGCCGT 3′. Tshz3 Forward: 5′ CACTCCTTCCAGCATCTCTGAG 3′; Tshz3 Reverse: 5′ TAGCAGGTGCTGAGGATTCCAG 3′.
4
Shikonin Cytotoxicity and Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell culture medium, Dulbecoo’s modified Eagle’s medium (DMEM), DMEM/F12, alpha-Minimum essential medium, trypsin, penicillin–streptomycin, and Dulbecco’s Phosphate Buffered Saline (DPBS) were purchased from Corning Cellgro (Manassas, VA, USA). Fetal bovine serum (FBS) was purchased from Gibco (Invitrogen, Carlsbad, CA, USA). Purified shikonin (≥98%), dimethyl sulfoxide (DMSO), 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), hydrochloric acid (HCl), isopropanol, RIPA buffer, protease inhibitor cocktail and Tris-buffered saline/Tween 20 (TBST) were purchased from Sigma (St. Louis, MO, USA). Antibodies against dual specificity phosphatase (DUSP)-1, DUSP-2, β-actin and horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). Antibodies against mouse phospho-JNK 1/2, JNK 1/2, phospho-p38 mitogen-activated protein kinase (MAPK), and p38 MAPK, and phospho-ERK 1/2, ERK 1/2 were purchased from Cell Signaling (Farmingdale, NY, USA). Pierce BCA Protein Assay Kit and ECL chemiluminescence substrate were purchased from Thermo Scientific (Rockford, IL, USA). TRIzol reagent, SuperScript® VILO™ cDNA Synthesis kit, SYBR® GreenER™ qPCR SuperMixes were purchased from Life Technologies (Carlsbad, CA, USA). RNA 6000 Nano LabChip kit was obtained from Agilent Technologies (Palo Alto, CA, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!