RNA was extracted from 3 dpf larvae at 4 hpl from cimetidine and vehicle-treated groups (50 larvae/group/experiment) using the RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. We enriched the injury sites by cutting away rostral and caudal parts from the larvae. Genomic DNA was removed by using Turbo DNA-free kit (AM1907, Invitrogen), according to manufacturer's instructions and PCR primers were designed using the Primer-BLAST website from NCBI with preference on an exon-exon junction set to on. cDNA was synthesized using the iScript™ cDNA Synthesis Kit (BioRad, cat. no. 1708890) according to the manufacturer's instructions. Reverse transcription-PCR was performed with the following set of primers: il-1β - fw 5' ATGGCGAACGTCATCCAAGA 3' and rv 5' GAGACCCGCTGATCTCCTTG 3', analyzed-actin fw 5' CACTGAGGCTCCCCTGAATCCC 3' and rv 5' CGTACAGAGAGAGCACAGCCTGG 3', hrh2a - fw 5' CACGCCCATTCTTCAAAAGG 3' and rv 5' CCATTTGTAGCGCTGTTATCGTC 3', and hrh2b - fw 5' GCTGCTGAAAGCGTTTGGAA 3' and rv 5' GAATACGCCGCACCTGTTC 3' 33 (link). qRT-PCR was performed using the SsoAdvanced Universal SYBR Green Supermix kit (BioRad) according to the manufacturer's instructions and run in triplicates on a LightCycler 96 instrument (Roche). The data was analyzed using the LightCycler 96 application software v1.1 (Roche).
Lightcycler 96 application
Manufactured by Roche
The LightCycler 96 is a real-time PCR instrument designed for gene expression analysis, genotyping, and other quantitative PCR applications. It features a compact, user-friendly design and supports multiple detection formats, including SYBR Green, hydrolysis probes, and intercalating dyes. The system provides precise temperature control and fluorescence detection capabilities to enable reliable and accurate quantification of target nucleic acid sequences.
Automatically generated - may contain errors
Lab products found in correlation
Lightcycler 96 instrument, by Roche (2 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Iscript cdna synthesis kit, by Bio-Rad (1 mentions)
Ssoadvanced universal sybr green supermix kit, by Bio-Rad (1 mentions)
Turbo dna free kit, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
2 protocols using lightcycler 96 application
1
Gene Expression Analysis of Larval Cimetidine Response
2
Quantitative RNA Analysis Pipeline
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with RNeasy Plus Mini Kit (Qiagen), quantified and used for cDNA synthesis with Primescript RT Master Mix (Clontech). qPCR reactions were run with SYBR® Premix Ex Taq (Tli RNAse H Plus) master mix (Clontech) on LightCycler® 96 Instrument and analysed using LightCycler® 96 Application (Roche Life Science). Primer sets used are provided in Supplemental methods (Table S7).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!