The largest database of trusted experimental protocols

Rabbit anti vimentin mab

Manufactured by Thermo Fisher Scientific

Rabbit anti-vimentin mAb is a monoclonal antibody raised against the vimentin protein. Vimentin is an intermediate filament protein found in various cell types. This antibody can be used for the detection and analysis of vimentin expression in biological samples.

Automatically generated - may contain errors

2 protocols using rabbit anti vimentin mab

1

Investigating miR-29b-3p in EMT Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The oligonucleotides of miR-29b-3p mimics and negative control miRNA were synthesized by Thermo Fisher Scientific (Waltham, MA). The sequence of the oligonucleotides used for miR-29b-3pmimics.
5′-UAGCACCAUUUGAAAUCAGUGUU-3.
Lipofectamine RNAiMAX was purchased from Invitrogen (Carlsbad, CA). Rabbit mAbs to E-cadherin and calretinin, were purchased from Abcam (Cambridge, UK), Cell Signaling Technology (Danvers, MA). Recombinant- TGF-β1 was purchased from R&D systems (Minneapolis, MN). Rabbit anti-vimentin mAb and anti-rabbit Ig conjugated with AlexaFluor 488 or AlexaFluor 595® were from Invitrogen. DAPI was obtained from Dojindo (Kumamoto, Japan). Anti-integrin β1 mAb and RGD peptide were purchased from Cayman Chemical Co. (Ann Arbor, MI).
All methods were carried out in accordance with guidelines and regulations of the Declaration of Helsinki and all experimental protocols were approved by the Institutional Review Boards of Jichi Medical University (Approval number: RIN-A-19-161).
+ Open protocol
+ Expand
2

Immunofluorescence Analysis of miR-29b Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rabbit mAbs to E‐cadherin, calretinin, and FN, were purchased from Abcam and Cell Signaling Technology. Recombinant TGF‐β1 was purchased from R&D Systems. Rabbit anti‐vimentin mAb and anti‐rabbit IgG conjugated with Alexa Fluor 488 or Alexa Fluor 595, anti‐mouse IgG conjugated with Alexa Fluor 647 were obtained from Invitrogen. We obtained DAPI from Dojindo. Anti‐mouse CD31, CD34, CD44, CD49d, CD73, and CD90 were obtained from BioLegend. Anti‐human CD9 and CD63 were obtained from BD Biosciences. The lentivirus plasmid of miR‐29b precursor and negative control miRNA as well as the pLV‐miRNA Expression Vector System were purchased from Biosettica. The sequence of the oligonucleotides used for miR‐29b precursor (hsa‐mir‐29b‐1) is as follows:
CUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGG.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!