Direct zol rna extraction kit

With careful aspiration, cell culture media and GBM cells from the cell culture insert were transferred to a 15 mL conical tube. The membrane of the cell insert was gently scrubbed with the end of a serological pipette and rinsed with culture media to remove any attached GBM cells. Similarly, NSC cells from the well, along with the media, were moved to a separate tube. Both cell lines were centrifuged at 0.3 rcf for 5 min at room temperature. The supernatant was then discarded, and the cells were resuspended in 500 µL of ice-cold 1x PBS, followed by another centrifugation at 0.3 rcf for 5 min at 4 °C. The supernatant was removed, and the cell pellet was resuspended in 500 μL of TRIZOL reagent. GBM and NSC cells were processed separately for RNA extraction following the same protocol. Total RNA was extracted using the Direct-zol RNA extraction kit (Zymo Research, Irvine, CA, USA, catalog #R2050), following the manufacturer’s protocol, including the in-column DNase treatment to remove genomic DNA contamination. All the centrifugations were performed at 12,000 rcf for 30 s. The extracted RNA was stored at −20 °C for further use.

We performed additional transcriptome sequencing of A. californica and Conus furvus. Specimens of A. californica were ordered from the National Resource for Aplysia at the University of Miami, FL, United States. Animals were anesthetized as previously described (Zhao et al., 2009 (link)). The venom gland of a single specimen of C. furvus was also dissected for sequencing. C. furvus was included in this study to provide an additional mollusk-hunting cone snail for the analyses. Total RNA was extracted using the Direct-zol RNA extraction kit (Zymo Research), with on-column DNase treatment and an additional wash step after the first purification, according to the manufacturer’s instructions. Library preparation and sequencing were performed by the University of Utah High Throughput Genomics Core Facility as previously described for different cone snail tissues (Koch et al., 2022 (link)). The SRA generated in this paper have been deposited with accession numbers SRR22829302, SRR23242094-SRR23242120.

RNA was extracted using Direct-zol RNA extraction kit (Zymo Research) from two biological replicates for each sample of cells at PPs and pancreatic islets stages of differentiation. mRNA was captured from 1 μg of total RNA using NEBNext (Poly A) mRNA magnetic isolation kit (NEB, E7490) according to the manufacturer’s instructions. NEBNext ultra directional RNA library prep kit (NEB, E7420L) used to NEBNext ultra directional RNA library prep kit (NEB, E7420L) used to prepare RNA-seq libraries which is sequenced on an Illumina Hiseq 4000 system. The initial processing of the raw data involved basic trimming and quality control, which was carried out using Illumina BCL2Fastq Conversion Software v2.20.

All RNA extractions were performed using Direct-zol RNA extraction kit (Zymo Research)following the manufacturer protocol. Quantitative real time PCR reactions were performed using a TaqMan Fast Virus 1-step Master Mix (Thermofisher) and run on an Applied Biosystems machine. Following primers were used in this study to detect MARV VP40 Fwd: GCGTATAACGARCGAACAGTCA Rev: AGCCACAGTATGRGCTARTATTC probe: FAM-AAATTGCTCATRATCCCRAGAGGCAGCCA-TAMRA, EBOV GP gene^{60 (link)} or LASV S gene (Fwd: CCATTCCTAACTTCAATCARTATGARGCAATGAG; Rev: GGTCTAGAAAACTGGCAGTGATCTTCCCA; Probe: FAM-ATGAGRATGGCNTGGG-MGB), VSV-M gene (Fwd: TGATACAGTACAATTATTTTGGGAC; Rev: GAGACTTTCTGTTACGGGATCTGG; Probe: FAM-ATGATGCATGATCCAGC-MGB) or SARS-CoV-2 E gene as previously described^{33 (link)}. RNase P RNA was used as an endogenous control for normalization. Relative vRNA level was measured by 2^−ΔΔCt method.