Q5 hot start high fidelity dna polymerase
The Q5 Hot Start High-Fidelity DNA Polymerase is a DNA polymerase enzyme that is designed for high-fidelity DNA amplification. It offers enhanced specificity, efficiency, and accuracy compared to standard DNA polymerases, making it suitable for various applications that require precise DNA replication.
Lab products found in correlation
246 protocols using q5 hot start high fidelity dna polymerase
Multiplex PCR for Pfcrt Genotyping
Construction of cDNA Clone for BDV FNK2012-1
Quantitative Analysis of Pou2f2 Isoforms
Quantitative real-time PCR was performed on 1/100 of the retrotranscription reaction using iTaqTM universal SYBR® Green Supermix (BioRad, 172-5124) on a CFX ConnectTM Real-Time System (BioRad) with the BioRad CFX Manage 3.1 software. Each reaction was performed in duplicate and relative mRNA quantities were normalized to the housekeeping gene RPL32 (primer information available on request). Relative expression changes between conditions were calculated using the ΔΔCt method. All changes are shown as fold changes.
Characterizing PNKP Lysine Mutants
High-Throughput Genomic Sequencing Workflow
5' RACE Mapping of Eukaryotic Transcripts
The gene specific primers are listed below
NSR1 5′ GATTCGGAGGAAGAGGAAGAGAC 3′
NIP7 5′ GCTTAGCCAATACTGTCAAAGAAGT 3′
SAR1 5′ TGACCACCCAAATCGAAAGTTGT 3′
Comprehensive LCMV RNA Sequencing Protocol
Whole Genome Sequencing of SARS-CoV-2 using Nanopore
Optimized Amplification Protocols for DNA Barcoding
Targeted Rumen Bacteria Profiling
Methods which performed consistently to give intact, good quality DNA with clean PCR bands for all targeted bacteria were finalized further for 16S rRNA gene sequencing and identification studies.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!