Viia7

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom, Italy, Switzerland, China, Australia, Canada, Germany, Denmark

The ViiA7 is a real-time PCR system designed for genetic analysis. It is capable of detecting and quantifying nucleic acid sequences in a variety of sample types. The ViiA7 provides precise, reliable, and efficient real-time PCR performance.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

ViiA7 real-time PCR machine (104 citations) ViiA7 machine (42 citations) ViiA7 real-time PCR (27 citations) ViiA7 platform (26 citations) ViiA7 Software v1.1 (24 citations) Applied Biosystems ViiA7 (22 citations) ViiA7 detection system (19 citations) ABI ViiA7 sequence detection system (17 citations) Viia7 Real-Time qPCR system (9 citations) Viia7 qPCR analyzer (9 citations)

579 protocols using viia7

Comprehensive qRT-PCR Protocol for Cell and Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

qRT-PCR was performed according to the protocol described previously^{2 (link)}. Briefly, cells were first lysed using TRIzol (Invitrogen). Pure RNA was then isolated using the ISOLATE II RNA Mini Kit from Bioline (Alexandria). For tissue samples, snap-frozen tissues were first homogenized using beads (Lysing Matrix D Bulk; MP Biomedicals) in TRIzol. RNA was then isolated as per manufacturer’s instructions using the ISOLATE II RNA Mini Kit from Bioline (Alexandria). 1 μg of RNA was then used to synthesize cDNA, using the Bioline cDNA synthesis kit containing oligo (dT) and random hexamers. All cDNA was then diluted in a 1:10 ratio to perform qRT-PCR.
2.5 μL of diluted cDNA, 0.75 μL of desired primer (2 μM), 3.75 μL of SYBR green (SensiFAST SYBR Lo-ROX kit; Bioline), and 0.5 μL of DNase and RNase free water were mixed and measured on a Real-Time PCR System (Applied Biosystems ViiA 7; Life Technologies Corporation) for 40 cycles. The resulting Ct values were then analysed using the ViiA 7 software (Life Technologies Corporation). The relative expression of target genes was determined by the ΔΔCt method and normalized to housekeeping gene GAPDH or Ywhaz and expressed as a fold difference to the mean of the relevant control samples. See tables S1 (human) and S2 (mouse) for details on primers used in this study.

Sajiir H., Wong K.Y., Müller A., Keshvari S., Burr L., Aiello E., Mezza T., Giaccari A., Sebastiani G., Dotta F., Ramm G.A., Macdonald G.A., McGuckin M.A., Prins J.B, & Hasnain S.Z. (2024). Pancreatic beta-cell IL-22 receptor deficiency induces age-dependent dysregulation of insulin biosynthesis and systemic glucose homeostasis. Nature Communications, 15, 4527.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Muscle biopsies were homogenized in lysis reagent (QIAzol; Qiagen, code: 79306) using a handheld tissue ruptor. The homogenate was placed at the benchtop for 5 min to promote dissociation of nucleoprotein complexes. Chloroform (1:5) was then added to the tube and shaken vigorously for approximately 15 s. The homogenate was centrifuged at 18,600 × g at 4°C for 15 min, after which the upper aqueous phase was transferred to a new tube. After the addition of 1.5 vol of 100% ethanol, total RNA was purified using an RNeasy Mini Kit according to the manufacturer's instructions (Qiagen, code: 74106). Reverse transcription was performed using reverse transcription reagents (TaqMan; Applied Biosystems, code: 4368813) from 1 μg RNA. Real‐time quantitative reverse transcript polymerase chain reaction (qRT‐PCR) was performed with a gene expression assay (TaqMan; Applied Biosystems) and real‐time PCR system (ViiA 7; Applied Biosystems). Thermal‐cycling conditions were 50°C for 2 min, 95°C for 20 s, and 40 cycles of 95°C for 1 s and 60°C for 20 s. Data were analyzed with ViiA 7 software (Applied Biosystems). Expression of ribosomal 18s RNA and glycolytic enzyme glyceraldehyde 3‐phosphate dehydrogenase were used as internal standards or “housekeeping genes.” All genes are listed in Table S1 (refer to Supplementary Material online).

El‐Habta R., Kingham P.J, & Backman L.J. (2017). Adipose stem cells enhance myoblast proliferation via acetylcholine and extracellular signal–regulated kinase 1/2 signaling. Muscle & Nerve, 57(2), 305-311.

+ Open protocol

+ Expand

Quantifying Metalloprotease Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Preliminary experiments to evaluate the gene expression of different metalloproteases (MMPs) in NCI-H295R, MUC-1, and TVBF-7 cell lines were performed using the Human Tumor Metastasis RT2 Profiler PCR Array (Qiagen, Milan, Italy). RNA isolation, treatment with DNase, and RNA purification were performed using the Qiagen kit (Qiagen, Milan, Italy). For cDNA synthesis, the RT2 First-Strand Kit (Qiagen, Milan, Italy) was used. PCR was performed with VIIA7 (Applied Biosystems, Monza, Italy) using RT2 SYBR Green qPCR Mastermix (Qiagen, Milan, Italy) as the fluorochrome.
For the other gene expression analysis, total RNA was extracted from cells using the RNeasy kit (Qiagen, Milan, Italy), and 1 µg was transcribed into cDNA, using murine leukemia virus reverse transcriptase (Promega, Milan, Italy). Gene expression was evaluated by q-RT-PCR (VIIA7, Applied Biosystems, Monza, Italy) using SYBR Green as the fluorochrome. Specific primers for MMP2, TIMP1, and TIMP2 were as follows: MMP2 (F: 5′–ACGACCGCGACAAGAAGTAT–3′ and R: 5′–ATTTGTTGCCCAGGAAAGTG–3′), TIMP1 (F: 5′–GGGACACCAGAAGTCAACCA–3′ and R: 5′–GGCTTGGAACCCTTTATACATC–3′), and TIMP2 (F: 5′–AAGCGGTCAGTGAGAAGGAA–3′ and R: 5′–TCTCAGGCCCTTTGAACATC–3′). Expression levels were normalized to the β-actin mRNA level of each sample, obtained from parallel assays.

Tamburello M., Abate A., Rossini E., Basnet R.M., Zizioli D., Cosentini D., Hantel C., Laganà M., Tiberio G.A., Grisanti S., Memo M., Berruti A, & Sigala S. (2023). Preclinical Evidence of Progesterone as a New Pharmacological Strategy in Human Adrenocortical Carcinoma Cell Lines. International Journal of Molecular Sciences, 24(7), 6829.

+ Open protocol

+ Expand

Real-Time PCR Analysis of ROCK and Rho-A Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Real-time PCR was performed in a Real-time PCR System (Applied Biosystems ViiA™ 7, USA). A PCR mix of 20 μl included 10.0 μL TaqMan Gene Expression Master Mix (2×), 1.0 μL TaqMan Gene Expression Assay (20×), 2.0 cDNA template, 7.0 Nuclease-free H2O. The thermal cycle conditions for the Uracil DNA Glycosylase (UDG) incubation at 50 °C for 2 minutes, AmpliTaq Gold, UP Enzyme Activation at 95 °C for 10 minutes, followed by 40 cycle denaturing at 95 °C for 15 seconds, and after then Anneal/Extend at 60 °C for 1 minute. Reference sample was made by mixing the control group RNAs. Reactions were incubated in a 96-well plate. Actin Beta (ACTB) (Hs99999903_m1) was used as endogenous control in real-time PCR. ROCK-1 (Hs01127699_m1), ROCK-2 (Hs00178154_m1), Rho-A (Hs00357608_m1) genes expression levels were determined with TaqMan Gene Expression Assays (Thermo Fisher Scientific, USA). All reactions were taken in triplicate. Analyses were performed with ViiA™ 7 Software (Applied Biosystems).

Görür K., Büyükafşar K., Akbaş E., İsmi O., Yolal Ertural D., Çetinkaya A, & Özcan C. (2021). RhoA, ROCK-1, and ROCK-2 Gene Expression and Polymorphisms in Cholesteatoma Patients. The Journal of International Advanced Otology, 17(6), 530-535.

+ Open protocol

+ Expand

Analyzing Hedgehog and WNT Signaling in Mouse Tooth Germs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse tooth germs were dissected from E18.5 mandibles. Under a dissection microscope, tooth germs were separated from surrounding tissues with forceps. For analysis of Hedgehog signaling and WNT signaling, total RNA was isolated from tooth germs homogenized in Trizol (Life Technology) according to standard protocols. Quantitative real-time PCR (Q-RT-PCR) was performed using Applied Biosystems ViiA7, with the following taqman probes: Axin2: Mm00443610_m1, Lef1: Mm00550265_m1, Gli1: Mm00494654_m1, Ptch1: Mm00436026_m1, and Gapdh: Mm99999915_g1. MEFs were prepared form E12.5 embryos and cultured in (DMEM with 10% Fetal bovine serum (FBS) according to previously described method (35 (link)). For arresting cell cycles and allowing growth of primary cilia, MEFs were cultured in MEF culture media (DMEM with 0.5% FBS) for at least 18 h. WNT signaling was induced by treating cells with WNT3A in concentration of 100 μg/ml for 18 h. Then total RNA was isolated from non-treated or treated cells. Then, 1 μg of total RNA was reverse transcribed using SuperScript Reverse Transcriptase (Life Technologies, Grand Island, NY, USA). Q-RT-PCR for examining induction of WNT signaling was performed in using Applied Biosystems ViiA7, with the following taqman probes: Axin2: Mm00443610_m1, Lef1: Mm00550265_m1, and Gapdh: Mm99999915_g1.

Zhang H., Chinoy A., Mousavi P., Beeler A., Louie K., Collier C, & Mishina Y. (2022). Elevated WNT signaling and compromised Hedgehog signaling due to Evc2 loss of function contribute to the abnormal molar patterning. Frontiers in dental medicine, 3, 876015.

+ Open protocol

+ Expand

Protein Characterization by SDS-PAGE and DSF

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein purity and size were assessed by standard reducing sodium-dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).¹⁶ Qualitative analysis of the oligomeric state distribution in solution at equilibrium (scFv monomer-to-dimer ratio) was determined by calculating the area under each elution peak from size exclusion chromatography (Superdex 75 pg, GE Healthcare) using Unicorn software (GE Healthcare). Protein solubility was determined by quantifying the concentration of soluble protein after concentration of the protein to ~20 mg/mL, incubation for four days at 4 °C, and centrifugation to pellet insoluble material. Thermal stability was evaluated by differential scanning fluorimetry (DSF).^{17 (link)} Briefly, purified protein (20 μl of 200μM) or buffer blank were mixed with Sypro Orange (1 μl of a 1:1000 dilution; Molecular Probes), heated in a Real Time PCR machine (Viia™7; Applied Biosystems) at increments of 0.96°C/min from 25°C to 90°C and analyzed with Viia™7 software (Applied Biosystems) for the melting temperature (T_m), the midpoint of unfolding. Reported values are averages of at least two independent samples.

Kalyoncu S., Hyun J., Pai J.C., Johnson J.L., Entzminger K., Jain A., Heaner DP J.r., Morales I.A., Truskett T.M., Maynard J.A, & Lieberman R.L. (2014). Effects of protein engineering and rational mutagenesis on crystal lattice of single chain antibody fragments. Proteins, 82(9), 1884-1895.

+ Open protocol

+ Expand

Comprehensive Molecular Profiling of Pancreatic Development

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells with the miRNeasy mini kit (Qiagen). cDNA synthesis was performed with a high-capacity RNA-to-cDNA kit (Applied Biosystems). TaqMan qPCR was performed under standard conditions using ViiA7 (Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems). Samples were normalized to housekeeping genes 18S ribosomal RNA (RN18S) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Taqman probes (Applied Biosystems): PDX1, Hs00236830_m1; SOX9, Hs01001343_g1; PTF1A, Hs00603586_g1; HNF1B, Hs01001602_m1; OCT4, Hs00999632_g1; NANOG, Hs04260366_g1; GAPDH, Hs02758991_g1; 18S, Hs99999901_s1; NKX6.1, Hs01055914_m1; NKX2.2, Hs00159616_m1.
SYBR qPCR was performed under standard conditions using ViiA7 (Applied Biosystems) and SYBR™ Green PCR Master Mix (Applied Biosystems). Samples were normalized to the housekeeping gene ACTB. Primers were as follows:

HHEX forward: ACGGTGAACGACTACACGC.

HHEX reverse: CTTCTCCAGCTCGATGGTCT;

MEIS1 forward: GGGCATGGATGGAGTAGGC.

MEIS1 reverse: GGGTACTGATGCGAGTGCAG;

ONECUT1 forward: GAACATGGGAAGGATAGAGGCA.

ONECUT1 reverse: GTAGAGTTCGACGCTGGACAT;

RFX6 forward: AAGCAGCGGATCAATACCTGT.

RFX6 reverse: ACCGTGGTAAGCAAACTCCTT;

ACTB forward: CCCAGAGCAAGAGAGG.

ACTB reverse: GTCCAGACGCAGGATG.

Wang X., Sterr M., Burtscher I., Chen S., Hieronimus A., Machicao F., Staiger H., Häring H.U., Lederer G., Meitinger T., Cernilogar F.M., Schotta G., Irmler M., Beckers J., Hrabě de Angelis M., Ray M., Wright C.V., Bakhti M, & Lickert H. (2018). Genome-wide analysis of PDX1 target genes in human pancreatic progenitors. Molecular Metabolism, 9, 57-68.

+ Open protocol

+ Expand

Thermal Stability of Fusion Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 5

Thermal stability of the fusion proteins of the invention was determined by Differential Scanning Fluorimetry. Each probe was transferred at a concentration of 0.1 μg/μL to a MICROAMP® Optical 384-well plate (ThermoFisher), and SYPRO Orange dye was added at suitable dilution. A temperature ramp from 25 to 95° C. was programmed with a heating rate of 1° C. per minute (ViiA-7 Applied Biosystems). Fluorescence was constantly measured at an excitation wavelength of 520 nm and the emission wavelength at 623 nm (ViiA-7, Applied Biosystems). Similar melting points correlate to related protein structures.

US11813336B2. Targeted compounds for the site-specific coupling of chemical moieties comprising a peptide linker (2023-11-14). Navigo Proteins GmbH [DE]. Inventors: Ulrich Haupts [DE], Markus Liebscher [DE], Erik Fiedler [DE].

+ Open protocol

+ Expand

Thermal Stability Profiling of Purified Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

The purified protein was mixed with SYPRO orange fluorescent dye (Life Technologies S6650) in a 96-well optical qPCR plate. The optimal dye and protein concentration were determined experimentally. All protein dilutions were performed in PBS, and a negative control sample containing the dye only was used for reference subtraction. The measurement was performed in a qPCR instrument (Applied Biosystems ViiA 7) using a temperature ramp from 25–95°C with a rate of 0.015°C per second. Data were collected continuously. The negative first derivative of the Sypro Orange signal was measured at several intervals during a temperature ramp up to 95°C.
For measurement in supernatants, constructs were expressed in a 96-well format and harvested 3-days post transfection. Samples were diluted with PBS pH 7.4 (GIBCO) containing 8-fold diluted supernatant and 500-fold diluted Sypro Orange dye (5000 x stock, Invitrogen). A mock sample was included as background control. The measurement was performed in a qPCR instrument (Applied Biosystems ViiA 7) using a temperature ramp from 25–95°C with a rate of 0.015°C per second. Data were collected continuously. The negative first derivative was plotted as a function of temperature. The melting temperature corresponds to the lowest point in the curve.

Rutten L., Gilman M.S., Blokland S., Juraszek J., McLellan J.S, & Langedijk J.P. (2020). Structure-Based Design of Prefusion-Stabilized Filovirus Glycoprotein Trimers. Cell Reports, 30(13), 4540-4550.e3.

+ Open protocol

+ Expand

Thermal Stability Evaluation of Binding Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 5

Thermal stability of the binding proteins of the invention was determined by Differential Scanning Fluorimetry (DSF). Each probe was transferred at concentrations of 0.1 μg/μL to a MicroAmp® Optical 384-well plate well plate, and SYPRO Orange dye was added at suitable dilution. A temperature ramp from 25 to 95° C. was programmed with a heating rate of 1° C. per minute (ViiA-7 Applied Biosystems). Fluorescence was constantly measured at an excitation wavelength of 520 nm and the emission wavelength at 623 nm (ViiA-7, Applied Biosystems). The midpoints of transition for the thermal unfolding (Tm, melting points) are shown for selected variants in Table 4.

US10584152B2. Binding proteins based on di-ubiquitin muteins and methods for generation (2020-03-10). Navigo Proteins GmbH [DE]. Inventors: Erik Fiedler [DE], Maren Meysing [DE].

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!