The samples were screened for five bacterial species associated with periodontitis. The amplification and detection were performed using the MiniOpticonTM Real-Time PCR System with an MJ MiniTM gradient thermal cycler (Bio-Rad Laboratories AB, Solna, Sweden). Data were processed and analyzed using the Bio-Rad CFX Manager. In a reaction mixture of 10 μl of Sso FastTM EvaGreen® Supermix (Bio-Rad) and 5 μl (1 μM) of each primer, 5 μl of the sample was added. The reactions were run in duplicate. The following primers (Invitrogen, Lidingö, Sweden) were used (forward and reverse, respectively): Fusobacterium spp., 5´-GGATTTATTGGGCGTAAAGC-3´ and 5´-GGCATTCCTACAAATATCTACGAA-3; for P. gingivalis, 5´-TGTAGATGACTGATGGTGAAAACC-3´ and 5´-ACGTCATCCCCACCTTCCTC-3´; for Prevotella intermedia, 5´-TTTGTTGGGGAGTAAAGCGGG-3´ and 5´-TCAACATCTCTGTATCCTGCGT-3´; for Tannerella forsythia, 5´-GCGTATGTAACCTGCCCGCA-3´ and 5´-TGCTTCAGTGTCAGTTATACCT-3´; and for T. denticola, 5´-TAATACCGAATGTGCTCATTTACAT-3´ and 5´-TCAAAGAAGCATTCCCTCTTCTTCTTA-3´ [14 ,15 ]. The reaction was run according to the protocol of Kuboniwa et al. [14 ]. The mean CT values were compared to standard curves to calculate the absolute quantifications of the samples.
Miniopticon real time pcr system
Manufactured by Bio-Rad
Sourced in United States, Germany, China, Japan, France
The MiniOpticon Real-Time PCR System is a compact, automated thermal cycler designed for real-time PCR analysis. It features a 48-well sample block and a five-channel optical detection system for fluorescence-based quantification of DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (31 mentions)
Iscript cdna synthesis kit, by Bio-Rad (19 mentions)
Rneasy mini kit, by Qiagen (14 mentions)
Sybr premix ex taq, by Takara Bio (12 mentions)
Trizol, by Thermo Fisher Scientific (11 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (9 mentions)
Iq sybr green supermix, by Bio-Rad (7 mentions)
Sybr green, by Thermo Fisher Scientific (7 mentions)
Dnase 1, by Thermo Fisher Scientific (7 mentions)
Quantinova reverse transcription kit, by Qiagen (5 mentions)
Ssoadvanced universal sybr green supermix, by Bio-Rad (5 mentions)
Nanodrop, by Thermo Fisher Scientific (5 mentions)
Ssofast evagreen supermix, by Bio-Rad (4 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Primescript rt master mix, by Takara Bio (4 mentions)
Itaq universal sybr green one step kit, by Bio-Rad (4 mentions)
Primescript rt reagent kit, by Takara Bio (4 mentions)
Dnase, by New England Biolabs (4 mentions)
Sybr green dye, by Bio-Rad (4 mentions)
Geneamp pcr system 2700, by Thermo Fisher Scientific (4 mentions)
168 protocols using miniopticon real time pcr system
1
Quantification of Periodontal Pathogens
2
RNA to cDNA Conversion and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FastKing gDNA Dispelling RT SuperMix (TIANGEN, Beijing, China) was used to transcribe the RNA to cDNA. Primer Premier 5.0 was used with MSActin as an internal reference. RT-qPCR was performed using the 2 × TSINGKE Master qPCR Mix (SYBR Green I; Tsingke, Nanjing, China) on a MiniOpticon TM Real-Time PCR System (Bio-Rad, Hercules, CA, USA). Each biological replicate consisted of three technical replicates, and relative expression was calculated according to the 2-ΔΔCT method.
3
Quantitative RT-qPCR for mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol Reagent (Thermo Scientific). For mRNA levels detection, cDNA was synthesized using the Revert Aid First Strand cDNA Synthesis Kit (#K1621) (Fermentas, Canada). RT-qPCR was performed using the Power SYBR Green PCR Master Mix on a MiniOpticonTM Real-Time PCR System (Bio-Rad, United States). The data were analyzed using the 2-ΔΔCt method, with CFX Manager Software package (Bio-Rad). GAPDH was used as an internal control.
4
Relative Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol (Invitrogen), and applied to cDNA synthesis using TaqMan MicroRNA Reverse Transcription Kit (ABI, Foster City, CA, USA). Real-time quantitative PCR were performed using MiniOpticonTM real-time PCR system (Bio Rad, Hercules, California, USA) with a QuantiTect SYBR Green kit (Bio Rad). The PCR primers were designed and synthesized by Invitrogen (Table 2 ). All the results were quantified based on β-actin as an internal standard. The optimized PCR program was 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s, 57 °C for 30 s and 72 °C for 1 min.
Primer used for real-time PCR experiment.
| Gene | RefSeq | 5′-3′ | |
|---|---|---|---|
| Atg7 | NM_028835 | Forward | TCCGTTGAAGTCCTCTGCTT |
| Reverse | TCCTACCACTTGGAGTCACC | ||
| Atgl | NM_025802.3 | Forward | CCTTAGGAGGAATGCCCTGC |
| Reverse | AACCCACTGGTAGACGGAAG | ||
| β-actin | NM_007393 | Forward | GAAATCGTGCGTGACATC |
| Reverse | GGAAGGAAGAACCCATACC | ||
| Cpt-1a | NM_013495.2 | Forward | GACTCCGCTCGCTCATTCC |
| Reverse | TCGGGAGTTTGTCTAGACGG | ||
| Hsl | NM_010719.5 | Forward | TATTCCTGCTGTGAGGGCAC |
| Reverse | TCCTAACCTACCAAACCCCC | ||
| Lal | NM_001111100.1 | Forward | GACCACTCCCGATGCAACTC |
| Reverse | GACCACTCCTTGTGAGCCAG | ||
| Lc3 | NM_025735.2 | Forward | CTTCGGCTTCTGAGTCAAGAGGAG |
| Reverse | GTGGTCGGTCGGATGGTGTAG | ||
| Pparα | NM_001113418.1 | Forward | TGGCTGCTATAATTTGCTGTGGAG |
| Reverse | CGTTGGTAGGTCTACTGTGGAAG | ||
| Pparγ | NM_011146 | Forward | GGAAGCCCTTTGGTGACTTTATGG |
| Reverse | CTGTAGGTTCTGTTGGACGACG | ||
5
Quantifying Gene Expression in Bone Marrow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bone marrow isolated from the right tibia using Isogen II (Nippon Gene, Tokyo, Japan), according to the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized from total RNA using PrimeScriptTM RT Master Mix (Takara, Shiga, Japan). cDNA was quantified by real-time reverse transcription polymerase chain reaction (RT-PCR) using the MiniOpticonTM Real-Time PCR System (Bio-Rad, Hercules, CA) and SYBR® Premix Ex TaqTM II (Takara). Cycling conditions were 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and 60°C for 30 s. The primer sequences are shown in Table 2 . Results from the bone marrow cells are expressed as the fold change relative to normal mice after normalization to 36B4 gene expression levels.
6
Quantification of miR-125b and Associated Targets
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol® reagent (Tiangen Biotech Co., Ltd.) was used to isolate total RNA. A total of 2 µg of each RNA sample was reverse transcribed into cDNA using FastQuant RT Super mix (Tiangen Biotech Co., Ltd.). qPCR was performed on a Bio-Rad MiniOpticon Real-Time PCR system (Bio-Rad Laboratories, Inc.) using a SYBR Green PCR Master mix (Tiangen Biotech Co., Ltd.). A Bugle-Loop™ miRNA qPCR kit (Guangzhou RiboBio Co., Ltd.) was used to quantify miR-125b and U6. Hsa-mir-125b-1_1_PR miScript Precursor Assay (Qiagen GmbH) was used for quantification of precursor miR-125b. The primer sequences were as follows: GAPDH forward, 5′-AGCCACAATCGCTCAGACAC-3′ and reverse, 5′-GCCCAATACGACCAAATCC-3′; Ago2 forward, 5′-CCTCCCATGTTTACAAGTCG-3′ and reverse, 5′-TCTTTGTCCTGCCACAATG-3′; STAT3 forward, 5′-CATATGCGGCCAGCAAAGAA-3′ and reverse, 5′-ATACCTGCTCTGAAGAAACT-3′; GUSB forward, 5′-AGCGTGGAGCAAGACAGTG-3′ and reverse, 5′-TCTGCATAGGGGTAGTGGCT-3′; and Pri-miR-125b forward, 5′-TGAACCTCGAACAGAAATTGCC-3′ and reverse, 5′-TCCACCAAATTTCCAGGATGC-3′.
7
Real-Time qPCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real-time quantification of gene expression, RFP and GFP double-positive cells were sorted by FACS directly into RLT buffer (Qiagen GmbH, Shanghai, China), and the RNA was extracted using RNeasy microcolumns (Qiagen GmbH) according to the manufacturer's instructions. Random hexamer-primed first-strand cDNA was prepared with a SuperScript III Reverse Transcriptase Kit (cat. no. 18080-051; Invitrogen) according to the manufacturer's instructions. Real-time PCR was performed using the Bio-Rad MiniOpticon Real-Time PCR System (Bio-Rad, Shanghai, China) in a two-step RT-PCR. All RNA samples were treated with DNAse I (Takara, Dalian, China) to remove genomic DNA contamination. cDNA was synthesized with M-MLV reverse transcriptase (Promega, Madison, WI, USA) according to the instructions in the manual. Mouse-specific sequences for PCR primers were designed to generate amplicons of 150–250 bp required for real-time PCR detection using iQ SYBR Green Supermix (Bio-Rad). The mRNA abundances were determined by normalization of the data to the expression levels of glyceraldehyde-3-phosphate dehydrogenase mRNA. The primers used for PCR were in Supplementary Material .
8
Deacylation and Polyadenylation of tRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
tRNA deacylation was performed as described previously [68 (link)], except that deacylation was performed at a pH of 10. A poly(A) tail was added to the deacylated 3′-CCA terminus using E. coli poly(A) polymerase (New England BioLabs), according to the product manual. Prior to reverse transcription, polyadenylated tRNA were denatured for 5 min with a TG primer (5′-T15GG-3′; 100 μM) and dNTPs (25 mM each) at 80°C and then chilled on ice. Reverse transcription was performed with RevertAid Premium Reverse Transcriptase (Fermentas), according to the product manual.
Specific primers for amplifying 39 E. coli tRNAs were designed using Primer-Premier 5 software and are listed inS3 Table . The specificity of these primers was verified both by in silico analysis (NCBI Primer-Blast) and melting-curve analysis after qPCR amplification. qPCR was then performed with each of the 39 tRNA-specific primer sets and SsoFast Evagreen Supermix (Bio-Rad) on a Bio-Rad MiniOpticon Real-Time PCR system (Bio-Rad), according to the manufacturer’s instructions.
Specific primers for amplifying 39 E. coli tRNAs were designed using Primer-Premier 5 software and are listed in
9
Quantification of AT2R Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from renal homogenates using Trizol Reagent (Invitrogen, San Diego, USA) according to manufacturer's instructions. Reverse transcription of total RNA (1 μg) was performed with Moloney murine leukemia virus reverse transcriptase (M-MLV Easy Script RT, Transgen Biotech, China), conforming to the manufacturer's instruction. RT negative controls were performed by omitting the reverse transcriptase. Each cDNA sample was amplified in triplicate with a MiniOpticon real-time PCR system (BioRad, USA) using Syber Green Real Mix (Biodynamics, Argentina). Amplification profile: 2 min at 94°C, followed by 45 cycles of 94°C for 15 s, 60°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 10 min. Primers sequences used were: AT2R sense 5'-CTGGCTGTGGCTGACTTACT-3', AT2R antisense 5'-CACTTTGCACATCACAGGTCC-3'; β-actin sense 5'-ATTGCTGACAGGATGCAGAA-3', β-actin antisense 5'-TAGAGCCACCAATCCACACAG-3'. PCR products length was checked on a 2% agarose gel.
Relative gene expression was calculated using the comparative Ct method. AT2R
gene expression was normalized with respect to β-actin expression. No changes were found in the expression of β-actin RNA between the different experimental groups.
Relative gene expression was calculated using the comparative Ct method. AT2R
gene expression was normalized with respect to β-actin expression. No changes were found in the expression of β-actin RNA between the different experimental groups.
10
Validating RNA-Seq via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the RNA-Seq analysis, RT-qPCR was performed on a set of eight randomly selected genes. DNase I treated RNA samples were reverse transcribed using First Strand cDNA Synthesis Kit (Thermo Scientific). Primers for RT-qPCR were designed using the Primer3Plus online software (www.bioinformatics.nl/primers3plus ) and their sequences are available in S1 Table . The RT-qPCR reactions were performed with the MiniOpticon Real-Time PCR System, Bio-Rad (Hercules, CA, USA) and the SYBR Green 2x Master Mix (Ampliqon) were used to detect transcript abundance. The reaction was performed using 1.5μl of first strand cDNA, 3μl of each primer and 7.5 μl SYBR Green Master Mix in a final volume of 15 μl. Negative control was also considered for each run. Cycling programs were incubation at 95 °C for 5 min, then 40 cycles of denaturation at 92 °C for 45 s, annealing at 60 °C for 45 s and extension at 72 °C for 45 s. The specificity of all products was verified via melting curve analysis by increasing the temperature from 60 °C to 95 °C and read every 0.5 °C. Three replicates were considered for each gene. Normalization of reads was done concerning the Actin 2 as the reference gene. The relative quantitative method (2-ΔΔCt) was used to estimate quantitative gene expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!