Eastep universal rna extraction kit

Total RNA was extracted using Eastep™ Universal RNA Extraction Kit (Promega), according to the manufacturer's handbook, and the concentration of total RNA was measured using a NanoDrop^® ND‐1000 (NanoDrop) at the wavelengths of 230, 260 and 280 nm. Complementary DNA was reversely transcripted using commercial iScript™ cDNA Synthesis Kit (Bio‐Rad), according to the manufacturer's instructions. A quantitative real‐time PCR assay was conducted using the SuperReal PreMix Plus (TianGen) and performed on an ABI 7,500 fast real‐time PCR system (ABI). The data were processed according to the 2^‐△△Ct method.

An Eastep Universal RNA Extraction Kit (Promega) was used to extract total RNA. Promega GoScript was used to perform reverse transcription. qRT-PCR was performed using the SYBR Green Master Mix (Yeasen, Wuhan, China) in a LightCycler 480 system. qRT-PCR is performed as follows: 95 °C for 5 min, followed by 40 cycles at 95 °C for 5 s and 60 °C for 30 s. Three technical replicates and three biological replicates were prepared for every gene. The internal control was rice actin 1.

Total RNA was extracted using Eastep™ Universal RNA Extraction Kit (Promega, Shanghai, China) from roots of 1-week-old plants, leaves and stems of 8-week-old plants, and floral buds of 10-week-old plants. RNA quality and concentration were assessed using electrophoresis and ND-1000 Spectrophotometer (NanoDrop Technologies, Delaware, USA). Two micrograms of total RNA were reverse transcribed using GoScript™ Reverse Transcription System (Promega). Quantitative RT-PCR (qRT-PCR) was performed with ABI7500 Real-Time PCR System using TransStart® Top Green qPCR SuperMix (TransGen, Beijing, China). BrrACT2 was used as reference gene. The primers are listed in Table S1. Triplet biological replicates were analyzed.

Total RNA was isolated from the WT and asa mutant plants using an Eastep Universal RNA Extraction Kit (Promega). First-strand cDNA was synthesized by reverse transcription using an M-MLV First Strand Kit (Invitrogen). Quantitative RT-PCR was performed using SYBR Premix Ex Taq II (TaKaRa) on an ABI Step One Real-Time PCR system (Applied Biosystems). The rice UBIQUITIN gene was used as an endogenous control. All primers for RT-PCR are listed in Supplementary Table S2. The comparative threshold cycle (CT) method was used to analyze the relative expression levels.

Total RNA was extracted from the SCN using an Eastep Universal RNA Extraction Kit (Promega) according to the standard protocol. The RNA concentrations were determined using a Nanodrop spectrophotometer (Thermo Scientific). Total RNA was reverse‐transcribed using the GoScript Reverse Transcription System (Promega). The cDNA solution was subjected to quantitative PCR in a Bio‐Rad iCycler iQ system using GoTaq® qPCR Master Mix (Promega). Quantitative PCR consisted of 40 cycles of 15 s at 95°C and 60 s at 60°C. The primer sequences were as follows:
Per1 forward primer 5′‐CTCTTCTGGCAATGGCAAGGACTC‐3′,
reverse primer 5′‐CTCAGGAGGCTGTAGGCAATGGA‐3′;
Clock forward primer 5′‐GACGGCGAGAACTTGGCATTGA‐3′,
reverse primer 5′‐TGAGACTGCGGTGTGAGATGACT‐3′;
Bmal1 forward primer 5′‐ATAAGGACTTCGCCTCTACCTGTTCA‐3′,
reverse primer 5′‐CCTCGTTGTCTGGCTCATTGTCTT‐3′;
Cry1 forward primer 5′‐GCCAGCAGACACCATCACATCAG‐3′,
reverse primer 5′‐GGGAAGGAACGCCATATTTCTCATCA‐3′;
GAPDH forward primer 5′‐AGAAGGTGGTGAAGCAGGCATCT‐3′,
reverse primer 5′‐CGGCATCGAAGGTGGAAGAGTG‐3′.
Temperature controlled melting curve analysis revealed a single peak corresponding to the specific amplification product. mRNA expression levels of clock genes in the SCN which related to the circadian rhythm, were calculated using the 2^−ΔΔCT method and analyzed using cosine software (Chronos‐Fit program).

For RNA extraction, the various strains were cultured in liquid CM at 28°C with constant shaking at 110 rpm for 2 days. Mycelial samples were then collected, and total RNA was extracted using the Eastep Universal RNA extraction kit (Promega, Shanghai, China). The PrimeScript RT reagent kit (TaKaRa) was used for cDNA synthesis; the transcription levels of the genes were detected using TB Green Premix Ex Taq II (TaKaRa) using specific primers (Table S2). β-Tubulin was used as an internal standard, and final data were calculated by the cycle threshold (2^−ΔΔCT) method (74 (link)). For whole-genome sequencing analysis, two independent spontaneous mutation strains of the ΔMotps2 mutant were cultured in liquid CM at 28°C at 110 rpm for 3 days. Mycelial samples were collected, and total DNA samples from the spontaneous strains were extracted and then sent for further whole-genome sequencing analysis (Novogene, Beijing). The sequence reads were mapped onto the reference genome of strain 70-15 (75 (link)). SV (structure variance) and SNP/indel (single-nucleotide polymorphism/insertion-deletion) analyses were carried out to identify the mutation sites in the spontaneous mutation strains.