Geneamp pcr system 9700 thermocycler

PCR amplifications were carried out using bacterial primers 341GC-F (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) and 534-R (ATTACCGCGGCTGCTGG) (Muyzer et al., 1993 (link)) for denaturing gradient gel electrophoresis (DGGE) analysis. All PCR amplifications were performed using a GeneAmp PCR system 9700 thermocycler (Applied Biosystems) as described by Folwell et al. (2016 (link)). Thermocycling consisted of 95°C for 5 min followed by 32 cycles of 95°C for 5 s, 55°C for 30 s, 72°C for 30 s, with a final elongation of 72°C for 7 min.

PCR amplification of the rpoB gene, which included the RRDR, was carried out using forward primer rpoBF2 (5’-GAG GGT CAG ACC ACG ATG AC-3’; nucleotide positions 1030 to 1049 according to H37Rv numbering, GenBank accession number CAB09390.1) and reverse primer rpoBR (5’-GAG CCG ATC AGA CCG ATG T-3’; nucleotide positions 1460 to 1478 according to H37Rv numbering) in a GeneAmp PCR system 9700 thermocycler (Applied Biosystems, Foster City, California, United States). The total volume of the PCR reaction used was 50 µL, containing: 5 µL of 10X high fidelity buffer, 1 µL of 10 mM dNTP mix, 2 µL of 50 mM MgSO₄, 1 µL of each primer, 0.2 µL of Taq HiFi (Invitrogen, Carlsbad, California, United States), 36.8 µL of molecular grade water and 3 µL of extracted genomic DNA. Amplification conditions were set at: 94°C for two minutes; followed by 35 cycles of 94°C for 30 seconds, 55°C for 30 seconds, 68°C for 40 seconds; followed by a 10-minute final elongation at 68°C. PCR products were purified using the GeneJet PCR purification kit (Thermo Scientific, Waltham, Massachusetts, United States) following the manufacturer’s instructions. 5 µL of the amplified product was visualised on a 1% agarose gel.

We designed a custom-made panel with 17 genes associated with a RTT-like phenotype based on the evidence curated in the Online Mendelian Inheritance in Man (OMIM). The genes are shown in Supplementary Table S3. Amplicon libraries were prepared using the Agilent HaloPlex Target enrichment system, for Illumina paired-end multiplexed sequencing platforms (Agilent Technologies), according to the manufacturer’s sample preparation protocol. Briefly, 225 ng of genomic DNA was digested with restriction enzymes. The hybridization was performed for 3 hours at 54 °C, and the circularized target DNA-HaloPlex probe hybrids, containing biotin, were captured on streptavidin beads (HaloPlex Magnetics Beads, Agilent Technologies). The DNA with adaptor-modified ends was PCR amplified (number of cycles depended on the lot, Herculase II fusion DNA polymerase, Agilent). The amplified target DNA was purified using AMPure XP beads (Beckman Coulter Genomics, GENEWIZ, New Jersey, USA). All of the DNA samples were individually indexed. Amplification of the libraries was performed on a GeneAmp®PCR System 9700 thermocycler (Applied Biosystems). The restriction digestion and amplicon library quantities were quality evaluated using a Bioanalyzer High Sensitivity DNA Assay kit in an Agilent 2100 Bioanalyzer (Agilent Technologies) and quantified using a Qubit 2.0 Fluorometer (Invitrogen).

Six transcripts of the Vg gene with dissimilar fragments per kilobase of transcript per million mapped reads (FPKM) values were recognized from the C. cautella female abdominal tissue transcriptome. The 6 Vg transcripts were evaluated through RT-PCR with gene specific primers synthesized from the 6 transcripts they had identified in the transcriptome assembly. Actin gene primers, Cc-Act-F1 and Cc-Act-R1, were used as internal controls (Additional file 5: Table S4). For validation, a cDNA library was exposed to PCR with the Gene Amp PCR system 9700 thermo cycler (Applied Biosystems, Foster City, CA, USA), and the following PCR conditions were used: initial denaturation at 94 °C for 1 min, followed by 32 cycles of denaturation at 94 °C for 30 s, and annealing at 68 °C for 3 min. The PCR-amplified products were run on 1.2% agarose gel, stained with ethidium bromide for 30 min, and visually observed under ultra violet light with the gel documentation system BioDocAnalyze (Biometra). The successful amplified samples were sent to BGI for sequencing.