Log In Sign up
The largest database of trusted experimental protocols

Pyromark q96 instrument

Manufactured by Qiagen
Visit Supplier
Sourced in Germany

The PyroMark Q96 instrument is a pyrosequencing system designed for DNA sequence analysis. It utilizes a sequencing-by-synthesis method to generate sequence data from DNA samples. The instrument is capable of processing up to 96 samples simultaneously and provides real-time analysis of the sequencing results.

Automatically generated - may contain errors

Lab products found in correlation

Epitect bisulfite kit, by Qiagen (3 mentions) Pyromark pcr kit, by Qiagen (3 mentions) Pyro q cpg software, by Qiagen (3 mentions) Pyromark gold q96 sqa reagents, by Qiagen (2 mentions) Pyromark cpg software, by Qiagen (2 mentions) Qiaamp dna mini kit, by Qiagen (2 mentions) Ez dna methylation kit, by Zymo Research (2 mentions) Nanodrop 2000c, by Thermo Fisher Scientific (2 mentions) Pyromark assay design 2, by Qiagen (2 mentions) Epitect plus dna bisulfite kit, by Qiagen (1 mentions) Pyromark assay design software, by Qiagen (1 mentions) Allprep dna rna protein mini kit, by Qiagen (1 mentions) Pyromark pcr master mix, by Qiagen (1 mentions) Coralload concentrate, by Qiagen (1 mentions) Pdrive cloning vector, by Qiagen (1 mentions) Qiaamp 96 dna blood kit, by Qiagen (1 mentions) Dneasy blood and tissue kit, by Qiagen (1 mentions) Streptavidin sepharose bead, by GE Healthcare (1 mentions) Hotstart plus dna polymerase, by Qiagen (1 mentions) Pyrosequencing assay design software, by Qiagen (1 mentions)

15 protocols using pyromark q96 instrument

1

Pyrosequencing for DNA Methylation Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The differential DNA methylation of candidate genes was validated in 16 NSCL and 15 healthy lip tissue samples by pyrosequencing. Genomic DNA was extracted and bisulfite-converted using an EpiTect Plus DNA Bisulfite Kit (Cat No. 59104, Qiagen, Germany) and EpiTect Bisulfite Kit (Qiagen), following manufacturer's protocols. PCR was performed using the conversed DNA samples as templates. Ten microliters of PCR products were analyzed on the PyroMark Q96 instrument (Qiagen). The primers used for pyrosequencing are listed in Table 2.
Xu X.Y., Wei X.W., Ma W., Gu H., Liu D, & Yuan Z.W. (2018). Genome-Wide Screening of Aberrant Methylation Loci for Nonsyndromic Cleft Lip. Chinese Medical Journal, 131(17), 2055-2062.
+ Open protocol
+ Expand
2

Targeted Bisulfite Pyrosequencing for DNA Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA extraction and sodium bisulfite treatment were performed in the same manner as above for WGBS sample processing. Bisulfite pyrosequencing primers were designed using PyroMark Assay Design software (Qiagen, Hilden, Germany) to target CpGs within DMRs from the male replication comparison. Bisulfite-converted DNA from each sample was amplified in triplicate for each primer set using the PyroMark PCR kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, except using 50 ng of bisulfite-converted DNA and 40 PCR cycles. Each PCR product was checked with gel electrophoresis for specific amplification. Pyrosequencing was conducted using PyroMark Gold Q96 SQA Reagents (Qiagen, Hilden, Germany) with the PyroMark Q96 instrument (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Mean percent methylation for each region was compared to diagnosis outcome using linear regression and compared to WGBS methylation using Pearson’s r.
Mordaunt C.E., Jianu J.M., Laufer B.I., Zhu Y., Hwang H., Dunaway K.W., Bakulski K.M., Feinberg J.I., Volk H.E., Lyall K., Croen L.A., Newschaffer C.J., Ozonoff S., Hertz-Picciotto I., Fallin M.D., Schmidt R.J, & LaSalle J.M. (2020). Cord blood DNA methylome in newborns later diagnosed with autism spectrum disorder reflects early dysregulation of neurodevelopmental and X-linked genes. Genome Medicine, 12, 88.
+ Open protocol
+ Expand
3

Allele-Specific ChIP Analysis of Kcnk9

Check if the same lab product or an alternative is used in the 5 most similar protocols
For allele-specific ChIP analysis, DNA of WT and Kcnk9KOmat (C57BL/6JxCast/Ei)F1 hybrid mice, treated either with DMSO or CI-994, was amplified in a PCR applying one non-biotinylated forward primer: 5′-AAATTCGCCGGTTCCTTCTAC-3′ and one biotinylated reverse primer: 5′-GAGATGTAGCGCACACGAAGC-3′. To distinguish the origin of the alleles we subsequently analyzed the PCR products in an allele-specific manner, using two neighboring SNPs, rs240891437 and rs47242380 (Ensembl; GRCm38.p5). The quantification of enrichment was performed using the pyrosequencing technique. A Kcnk9-specific pyrosequencing primer: 5′-AAGGAATGGGTGTGC-3′ was designed and pyrosequencing was carried out on a PyroMark Q96 instrument (Qiagen).
Cooper A., Butto T., Hammer N., Jagannath S., Fend-Guella D.L., Akhtar J., Radyushkin K., Lesage F., Winter J., Strand S., Roeper J., Zechner U, & Schweiger S. (2020). Inhibition of histone deacetylation rescues phenotype in a mouse model of Birk-Barel intellectual disability syndrome. Nature Communications, 11, 480.
+ Open protocol
+ Expand
4

Pyrosequencing Analysis of ANXA2 Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was extracted from tissues and cell lines using all Prep DNA/RNA/Protein mini kit (Qiagen) and quantified using NanoDrop2000c (Thermo Scientific). For pyrosequencing, genomic DNA was bisulfite modified using the EZ DNA methylation gold kit (The Epigenetics company) according to the manufacturer's instructions. Pyrosequencing analysis was performed using a PyroMark Q96 instrument (Qiagen), following the manufacturer's protocol. The following primers were used: ANXA2-pyr-for GGGTAGGGGTGAGTTATTTTTGATTT, ANXA2-pyr-rev biotin- ACAAAACCCAC- TAACCTAAATAAAACTTTTATACC, ANXA2-pyr-seq GGGTAGGGGTGAGTTATTTTTGATTT. The results were analyzed by PyroMark CpG software (Qiagen). The methylation index for each sample was calculated as the average value of CpG methylation in the CpG examined.
Kling T., Ferrarese R., Ó hAilín D., Johansson P., Heiland D.H., Dai F., Vasilikos I., Weyerbrock A., Jörnsten R., Carro M.S, & Nelander S. (2016). Integrative Modeling Reveals Annexin A2-mediated Epigenetic Control of Mesenchymal Glioblastoma. EBioMedicine, 12, 72-85.
+ Open protocol
+ Expand
5

DNA Methylation Analysis by MSP and Pyrosequencing

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA was isolated using QIAamp DNA Mini Kit (Qiagen) and bisulfite modification of the genomic DNA was carried out using an Epitect Bisulfite Kit (Qiagen) according to the manufacturer’s instructions. Methylation Specific PCR (MSP) primers were designed with Methprimer (http://epidesigner.com). Pyrosequencing for five CpG sites in the promoter region was performed on a PyroMark Q96 instrument (Qiagen) according to manufacturer’s protocol, as described previously [23 (link)]. Record was analyzed by the manufacturer’s software. All the primer sequences were listed in Additional file 1: Table S1.
Xiao W., Wang J., Li H., Xia D., Yu G., Yao W., Yang Y., Xiao H., Lang B., Ma X., Guo X., Guan W., Xu H., Liu J., Zhang X, & Ye Z. (2014). Fibulin-1 is epigenetically down-regulated and related with bladder cancer recurrence. BMC Cancer, 14, 677.
+ Open protocol
+ Expand
6

Quantifying LINE-1 DNA Methylation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasma DNAs were isolated using QIAmp UltraSense Virus Kits (Qiagen, Valencia, CA). Aliquots of DNA (500 ng) were bisulfite-treated with the EZ DNA methylation kit (Zymo Research, Orange, CA) following the manufacturer’s protocol. Pyrosequencing for LINE-1 methylation levels was carried out using PCR and sequencing primers as described previously [5 (link)]. Briefly, PCR was carried out in a 25 μl reaction mix containing 50 ng bisulfite-converted DNA, 1X Pyromark PCR Master Mix (Qiagen), 1X Coral Load Concentrate (Qiagen) and 0.2 μM forward and reverse primers. Following amplification, the biotinylated PCR products were purified and incubated with the sequencing primer designed to bind adjacent to the CpG sites of interest. Pyrosequencing was conducted using a PyroMark Q96 instrument (Qiagen), with subsequent quantitation of methylation levels determined with the PyroMark CpG 1.010 software. Relative peak height differences were used to calculate the percentage of methylated cytosines at each given site. Percent methylation within a sample was subsequently determined by averaging across all three interrogated CpG sites in the analysis.
Wu H.C., Shen J., Siegel A, & Santella R.M. (2021). Environmental exposure and clinical correlates of hepatocellular carcinoma in New York City: a case only study. Cancer causes & control : CCC, 33(1), 153-159.
+ Open protocol
+ Expand
7

Analysis of ZBTB18 promoter methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA from tissues and cell lines was bisulfite modified using the EZ DNA methylation–gold kit (The Epigenetics Company) according to the manufacturer's instructions. A pool of normal brain tissues or glioma samples were subjected to PCR to amplify ZBTB18 promoter CpG islands using PyroMark PCR kit (Qiagen) and primers summarized in Supplementary Table 3. Non-CpG containing primers, methylation-specific primers (MSP) and un-methylation-specific primers (USP) were designed to cover the entire region. PCR products were cloned into pDrive cloning vector (Qiagen) and submitted for sequencing with SP6 primer and T7 primer (GATC).
Pyrosequencing analysis was performed using a PyroMark Q96 instrument (Qiagen), following the manufacturers protocol. Primers are summarized in Supplementary Table 3. The results were analyzed by PyroMark CpG software (Qiagen). The methylation index for each sample was calculated as the average value of CpG methylation in the CpG examined.
Fedele V., Dai F., Masilamani A.P., Heiland D.H., Kling E., Gätjens-Sanchez A.M., Ferrarese R., Platania L., Soroush D., Kim H., Nelander S., Weyerbrock A., Prinz M., Califano A., Iavarone A., Bredel M, & Carro M.S. (2017). Epigenetic Regulation of ZBTB18 Promotes Glioblastoma Progression. Molecular cancer research : MCR, 15(8), 998-1011.
+ Open protocol
+ Expand
8

DNA methylation analysis of TXNIP gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
We extracted genomic DNA from the skeletal muscle biopsies using the DNeasy blood and tissue Kit, from the SAT biopsies using the QIAamp DNA Mini Kit, and from blood (buffy coats) using the QIAamp 96 DNA blood kit (all Qiagen). A total of 10–40 mg SAT and skeletal muscle tissue was used to extract 500 ng (skeletal muscle and blood) and 400 ng (SAT) DNA, respectively, which was then bisulfite converted using the EpiTect Bisulfite Kit (Qiagen). DNA methylation was then measured at CpG site cg19693031, located in the 3’UTR region approximately 3000 base pairs downstream from the TXNIP transcription start site, using bisulfite pyrosequencing. Methylation differences at this CpG site may alter the binding affinity of methylation-sensitive transcription regulators [16 (link)]. PyroMark Assay Design 2.0 software was used to design primers, and pyrosequencing of the PCR products was performed with the PyroMarkQ96 instrument (Qiagen). Primer sequences were as follows: forward primer, 5´-TGTTTGTTGGATGGGTTTAAAAATAATT-3´, reverse primer (biotinylated), 5´-AAACCTCCAAAAAACCTTAAAAAACTT-3´, sequencing primer, 5´GGGTTAGGTAAAAATGG -3´.
Houshmand-Oeregaard A., Hjort L., Kelstrup L., Hansen N.S., Broholm C., Gillberg L., Clausen T.D., Mathiesen E.R., Damm P, & Vaag A. (2017). DNA methylation and gene expression of TXNIP in adult offspring of women with diabetes in pregnancy. PLoS ONE, 12(10), e0187038.
+ Open protocol
+ Expand
9

Methylation Analysis by Pyrosequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The bisulfite converted DNA was amplified using Hotstart Plus DNA polymerase (Qiagen). PCR products were immobilized on streptavidin-sepharose beads (GE Healthcare), washed, denatured, and released into annealing buffer containing sequencing primer, which is described in Supplementary Table 2. Pyrosequencing was carried out on a PyroMark Q96 instrument (Qiagen) according to the manufacturer's instructions. Percent methylation was calculated using the Pyro Q CpG software (Qiagen).
Jiang Y., Zhu H., Chen H., Yu Y.C., Xu Y.T., Liu F., He S.N., Sagnelli M., Zhu Y.M, & Luo Q. (2022). Elevated Expression of lncRNA MEG3 Induces Endothelial Dysfunction on HUVECs of IVF Born Offspring via Epigenetic Regulation. Frontiers in Cardiovascular Medicine, 8, 717729.
+ Open protocol
+ Expand
10

Bisulfite Analysis of Peg13 DMRs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Approximately 500 ng DNA was subjected to sodium bisulfite treatment and purified using the EZ DNA Methylation Direct™ kit (Zymo Research). Bisulphite PCR primers for the Peg13-DMR1 and Peg13-DMR2 (located from +195 to +833 bp relative to the 5′ end of the Peg13 transcript) were designed using the Pyrosequencing Assay Design Software (Qiagen). PCR amplification was performed with 1 μg bisulfite converted DNA and specific primers at 42 cycles in a bisulfite PCR analysis. We amplified two CpG-rich regions, Peg13-DMR1 and Peg13-DMR2, associated with the mouse Kcnk9 gene regulation with the following primers: Peg13-DMR1, forward 5′-TTGGATGAGTTATTATATAAGGTTTAAAA-3′ and reverse 5′-ACAACTACCTACATTCCAAATCT-3′-biotinylated (product size: 175 bp), sequencing 5′-AAATTTTAATAAGATGGGTTAAT-3′. Peg13-DMR2, forward 5′-AGATTTGGAATGTAGGTAGTTGTGA-3′ and reverse 5′-CCTCAATAAAACCATTCTAATCAACTAT-3′-biotinylated (product size: 198 bp), sequencing 5′-GGTAATTTGTTAGGTGGAGATATA-3′. The pyrosequencing was carried out on the PyroMark Q96 instrument (Qiagen).
Cooper A., Butto T., Hammer N., Jagannath S., Fend-Guella D.L., Akhtar J., Radyushkin K., Lesage F., Winter J., Strand S., Roeper J., Zechner U, & Schweiger S. (2020). Inhibition of histone deacetylation rescues phenotype in a mouse model of Birk-Barel intellectual disability syndrome. Nature Communications, 11, 480.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!